1. Mutations 1

2. 2 What is a gene? ---TTGACAT------TATAAT-------AT-/-AGGAGGT-/-ATG CCC CTT TTG TGA ---AACTGTA------ATATTA-------TA-/-TCCTCCA-/-TAC GGG GAA AAC ATT (-10) (-35) PROMOTER 5’ 3’ 5’ antisense sense RIBOSOME BINDING SITE U-/-AGGAGGU-/-AUG CCC CUU UUG UGA 5’ 3’ Met Pro leu leu stp Prokaryotic Genes When ALL OF THESE RULES ARE SATISFIED THEN THEN A PIECE OF DNA WILL GENERATE A RNA WHICH WILL BE READ AND TRANSLATED INTO A PROTEIN.

3. 3 Reading the genetic code A T GT T TA A AT A GC C C 5’3’ C A TA A AT T TC T AG G G 5’3’ U A C Met A A A Phe U U U Lys S T P A U GU U UA A AU A GC C C 5’3’ 5’3’ C A TA A AT T TC T AG G G A U G U U U A A A U A G C C C 5’3’ A T GT T TA A AT A GC C C 5’3’

4. 4 No Gaps A U GU U UA A AU A GC C C 5’3’ U A C Met A A A Phe U U U Lys S T P A U GU U UA A AU A GC C C 5’3’ U A C Met A A U Asn U U A Leu

5. 5 No overlaps A U GA A AC C CU A GC C C 5’3’ U A C Met U U U Lys G G G Pro S T P A U GA A AC C CU A GC C C 5’3’ U A C Met U U U Lys U G G Trp

6. 6 UUU UUC UUA UUG CUU CUC CUA CUG AUU AUC AUA AUG GUU GUC GUA GUG UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG UAU UAC UAA UAG CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG UGU UGC UGA UGG CGU CGC CGA CGG AGU AGC AGA AGG GGU GGC GGA GGG Phe Leu Ile Met Val Ser Pro Thr Ala Tyr STOP His Gln Asn Lys Asp Glu Cys STOP Trp Arg Ser Arg Gly U C A G UCAG UCAGUCAGUCAGUCAGUCAGUCAGUCAGUCAG First letter Second letter Third letter The GENETIC CODE The code is a three letter code.

7. 7 The code 3 amino acids are specified by 6 different codons 5 amino acids are specified by 4 different codons 1 amino acid is specified by 3 different codons 9 amino acids are specified by 2 different codons 2 amino acids are specified by 1 different codons The degeneracy arises because More than one tRNA specifies a given amino acid A single tRNA can base-pair with more than one codon tRNAs do not normally pair with STOP codons ----UCC------UCA------AGC AGG Ser AGU Ser UCG Ser ----UCC------UCA------ AGG Ser AGG Ser

8. 8 The Genetic Code Properties of the Genetic code: 1- The code is written in a linear form using the nucleotides that comprise the mRNA 2- The code is a triplet: THREE nucleotides specify ONE amino acid 3- The code is degenerate: more than one triplet specifies a given amino acid 4- The code is unambiguous: each triplet specifies only ONE amino acid 5- The code contains stop signs- There are three different stops 6- The code is comma less 7- The code is non-overlapping

9. xxxxxx 9

10. 10 Generation of mutations Spontaneous mutations Replication induced mutations of DNA Usually base substitutions (Most errors are corrected) Meiotic crossing over can induce mutations Small additions and deletions AND Large changes as well Environment induced changes Exposure to physical mutagens - Radioactivity or chemicals Depurination (removal of A or G) Repair results in random substitution during replication Deamination (removal of amino group of base) (nitrous acid) Cytosine--uracil--bp adenine--replication-- Oxidation (oxoG) guanine--oxoguanine--bp adenine--replication -- Base analog incorporation during replication BU-T Intercalating agents

11. 11 Methods used to study mutations Gross chromosomal changes- deletions, insertions, inversions, translocations Cytology- microscopy- karyotype Small mutations Small deletions, insertions and point mutations Recombinant DNA technologies

12. Mutation rate 12 There are approximately 10 13 cells in the human body Each cell receives 10,000 DNA lesions per day (Lindahl and Barnes 2000). Most pervasive agent is UV. 100,000 lesions per exposed cell per hour (Jackson and Bartek 2009). Ionizing agents (X-rays/  -rays) are most toxic because they generate double strand breaks (Ward 1988). Chromosome instability (gain or loss of entire segments) is frequent - 40% of imbalances are entire arm imbalance while 45% are terminal segment imbalance (double strand break, nondysjunction etc) Sequencing 179 humans as part of the 1000 genome project: On average, each person is found to carry approximately 250 to 300 loss-of-function variants in genes of which 50 are in genes previously implicated in inherited disorders. 1.3 million short indels (1-10,000 bp) were identified and 20,000 large (>10,000 bp) variants were identified. Variation detected by the project is not evenly distributed across the genome: certain regions, containing repetitive sequences (sub-telomeres etc), show high rates of indels.

13. 13 Sequencing the whole genomes of a family (2010 Science 328 636). 98 crossovers in maternal genome 57 crossovers in paternal genome Mutation rate is 1x10 -8 per position per haploid genome (human genome is 3x10 9 bp) It was calculated that there are ~70 new mutations in each diploid human genome Some sites such as CpG sites mutate at a rate 11 times higher than other sites Exome sequencing of 2440 individuals (Science 2012 337 40) Each person has ~100 loss of function mutations (~35 nonsense). 20 loss of function mutations are homozygous Some alterations in sequence concentrate in specific geographic populations Rare changes are population specific and their frequencies vary for each geographic population

14. 14 Chromosomes and chromosome rearrangements Cytogenetics is the study of genetics by visualizing chromosomes. This area of research is germane to several areas of biological research. Cytogenetics has been fundamental to understanding the evolutionary history of a species (for example, although the Chimp and the human are morphologically very different, at the level of the chromosome (and DNA sequence) they are extremely similar. H = human C= chimp G = Gorilla O = Orang utang

15. 15 Chromosomes are classified by size, centromere position and banding pattern: Shown below is the human karyotype (description of the chromosome content of a given species) Karyotype is the chromosome description of length, number, morphology. Karyotype analysis is extremely important in medicine. Alternations in karyotypes are linked to birth defects and many human cancers. Metacentric- centromere in the middle Acrocentric- centromere off center telocentric centromere at one end Karyotype

16. 16 Banding patterns Specialized stains produce unique banding patterns along each chromosome. Banding patterns are extremely useful for detecting abnormalities in chromosome structure. For many of the chromosome stains- the molecular basis of the banding patterns is unclear. Nonetheless these techniques remain fundamental in many areas of genetic research

17. 17 MU to bp Genetic maps are based on recombination frequencies and describe the relative order and relative distance between linked genes. Remember genes reside on chromosomes. So what we would like to know is where are the genes located on the chromosomes 22% Rf = 22MU What does this mean in terms of chromosomes and DNA?

18. 18 Physical maps Physical maps provide information concerning the location of genes on chromosomes Where are the genes on chromosomes? Cytological studies have been successfully used to map genes to specific regions of a chromosome. For example in Drosophila in some cells the chromosomes become highly replicated and exhibit very characteristic banding patterns:

19. 19 In situ hybridization Salivary glands Squash on slide Denature/Stain polytene chromosomes label gene probe (you can only use this method if you have the gene cloned) Hybridize probe to polytene chromosomes Autoradiography

20. Chromosome loss 20 Chromosome instability- Elevated gain or loss of complete chromosomes Frequent in tumors Frequent in in vitro fertilized embryos Gross chromosomal rearrangements during in vitro fertilization. 40% of embryos carried entire chromosome imbalance Gain or loss of segments of chromosomes CNV- copy number variation of chromosome segments 5% of individuals genome displays CNV Synuclein gene CNV is involved in Parkinsons Many cancers- malignant cells most often gain additional copies of chromosome segments- genes in these segments are mis- expressed or mis-express other genes) Microarray hybridization of DNA from tissues of identical twins- differences at several loci seen (Bruder et al 2008) Microarray hybridization of DNA from different tissues of single individual (Piotrowski et al., 2008) Gross chromosomal rearrangements during in vitro fertilization 55% of embryos carried terminal imbalance (sub-telomere loss) (Vanneste et al., 2009) -microarray based screen of IVF 35 embryo

21. 21 Gross chromosomal changes The Cri du chat syndrome in humans is a result of a deletion in the short arm of chromosome 5. This was determined by comparing banding patterns with normal and Cri du Chat individuals Types of chromosome rearrangements that can be studied by karyotype analysis: GROSS CHROMOSOMAL CHANGES Deletions, Duplications, Inversions, Translocations

22. 22 DDIT Translocation A____B____C________D____E____F Normal Chromosome Deletions (deficiency) A____B____C________D____F Duplications A____B____C________D____E____E____F Inversions A____B____C________E____D____F A____B____C________D____E____FA____B____C________D____LH____I____J________K____LH____I____J________K____E____F

23. 23 Insertion and deletions are frequent: Sequencing 179 humans as part of the 1000 genome project: On average, each person is found to carry approximately 250 to 300 loss-of-function variants in genes of which 50 are in genes previously implicated in inherited disorders. 20,000 large structural variants were identified and 1.3 million short indels were identified. Variation detected by the project is not evenly distributed across the genome: certain regions, such as subtelomeric regions, show high rates of variation. 1 in 500 children have reciprocal translocation but Such translocations are usually harmless. (However gametes produced by the children will have defects). 1 in 50 children have inversions (small and large). The heterozygous inversion carrier generally show no adverse phenotype (but produce abnormal meiotic products from crossing-over in the inversion loop).

24. 24 Deletions Deletions are often detected cytologically by comparing banding patterns between the normal and the partially deleted chromosomes Deleted segment 46,XX, del(1)(q24q31) Female with a deletion of chromosome 1 on the long arm (q) between bands q24 to q31. Chromosome no femaledeletionchromosome1Band

25. 25 In many instances deletions are too small to be detected cytologically. In these instances genetic/molecular techniques are used. Since cytological deletions remove a contiguous set of genes, there is a high probability that an essential gene will be deleted. Therefore deletions will survive as heterozygotes and not homozygotes. A____B________C____D Normal A____________C____D Homologous deletion (Lethal?) A____________C____D A____B________C____D Heterologous deletion (NOT Lethal)

26. 26 Consequences of deletions B+ A+____/ \_____C+___________D+ A+___________C+___________D+ In individuals heterozygous for the deletion, pairing is disrupted in the regions surrounding the deletion. Therefore recombination is also significantly reduced in these regions. A deletion on one homologue unmasks recessive alleles on the other homologue. The effect is called pseudo- dominance. A+____b______c____________D+ A+___ _____C+___________D+ Genotype A+_____B+_____C+___________D+ Normal A+_____b______c____________D+ A+_____B+_____C+___________D+ Normal

27. 27 Deletions in X Females in DrosophilaXX Males in Drosophila XY or XO Deletion seriesphenotype sick dead sick

28. 28 Changes in chromosome structure Deletions: 1.Hemizygosity from large deletions results in lethality- even the smallest cytologically defined deletions take out tens of 1,000's of bps and are likely to remove essential genes. 2. Organisms can tolerate hemizygosity from small but not large deletions. The reason for this is not entirely clear and is placed under the rubric of disrupting the overall ratio of gene products produced by the organism

29. 29 Deletion mapping Deficiency mapping or deletion mapping: This provides a means of rapidly mapping a new mutation A deficiency or deletion is the loss of a contiguous series of nucleotides ATGATCGGGCCCATCAAAAAAAAAAAATCATCCCCCGGGG DELETION ATGATCGGGCCCATC CATCCCCCGGGG ATGATCGGGCCCATC|CATCCCCCGGGG Defined deficiencies are very useful for mapping genes

30. 30 Deficiency mapping Say we have 6 sites defined by point mutations within the rosy gene ---1-----2-----3-----4-----5-----6 ---------------------------------- ---------2------------------------ ---------------------4------------ --------------DDDDDDDDDD---------- Can we get intragenic recombinants that will restore normal rosy gene? ry2 and ry4?Y ry2 and the deletion?Y ry4 and the deletionN Say we isolate a new ry mutation you call it ry(zany) You cross it to the deletion and do not find any Recombinants Where does ry(z) map

31. 31 Deficiency mapping Say we have 6 sites defined by point mutations within the rosy gene ---1-----2-----3-----4-----5-----6 ---------------------------------- ---------2------------------------ ---------------------4------------ --------------DDDDDDDDDD---------- Can we get intragenic recombinants that will restore normal rosy gene? ry2 and ry4?YES ry2 and the deletion?YES ry4 and the deletion?No Say we isolate a new ry mutation you call it ry(z) You cross it to the deletion and do not find any recombinants Where does ry(z) map?

32. 32 Deficiency mapping Generate a heterozygote Gene point mutant/deletion mutant Ask if you get intragenic recombinants Heterozygote will be pseudodominant The single point mutation will be observed over the deletion

33. 33 Multiple deficiencies Specific deletions can define a series of regions within a gene ---1-----2-----3-----4-----5-----6----7----8-- ---------------------------------------------- DDDDDDDDDDDDDDDDDDDDDDDDDDDDD----------------- ------------------DDDDDDDDDDDDDDDDDDDDDD------ These two deletions define 4 regions within the gene IIIIIIIV Now say a newly isolated mutation does not produce normal recombinants with both deletions To which region does it map? Gene

34. 34 Multiple deficiencies Multiple deletions can define a series of regions within a gene ---1-----2-----3-----4-----5-----6----7----8-- ---------------------------------------------- DDDDDDDDDDDDDDDDDDDDDDDDDDDDD----------------- ------------------DDDDDDDDDDDDDDDDDDDDDD------ These two deletions define 4 regions within the gene IIIIIIIV  4-7+--+  1-5--++ + = If a mutation maps to this region, normal recombinant flies are produced - = If a mutation maps to this region, normal recombinant flies are NOT produced Now say a newly isolated white mutation does not produce normal recombinants with both deletions To which region does it map? Gene

35. 35 Duplications Individuals bearing a duplication possess three copies of the genes present in the duplicated region. In general, for a given chromosomal region, organisms tolerate duplications much better than deletions. 46,XY, dup(7)(q11.2q22) Male with a duplication of chromosome 7 on the long arm (q) between bands 11.2 to 22 A____B____C________D____E____F A____B____C________D____E____E____F normal Duplication

36. 36 Tandem duplications- Important class of duplications!!! This is a case in which the duplicated segment lies adjacent to the original chromosomal segment A B C D ------ A B C B C B C B C D Once a tandem duplication arises in a population, even more copies may arise because of asymmetrical pairing at meiosis. Remember when the homologs pair during prophase of meiosis I, they line up base-pair for base pair. Duplications lead to mistakes in this pairing mechanism

37. 37 Proper pairing: A____B____C____B____C____D____E Inappropriate pairing: A____B____C____B____C____D____E A____B____C____B____C__-----------__D____E A____B____C____B____C____D____E

38. 38 Tandem duplications expand by mistakes in meiosisI during pairing A BC BC D E a b c b c d e

39. 39 Tandem duplications expand by mistakes in meiosis during pairing A BC BC D E a b c b c d e Paired non-sister chromatids

40. 40 ABCBCD ABCBCD a b c b c d ABCBCD ABCBC BCD ABCD ABCBCD a b c b c d What happens if you get a crossover after mis-pairing in meiosisI? A BC BC D E a b c b c d e

41. 41 The four meiotic products of a crossover between regions B and C: A-B-C-B-C-D-E A-B-C-D-E A-B-C-B-C-B-C-D-E A-B-C-B-C-D-E This process may repeat itself many times, such that a small fragment of the genome is repeated 10,000 times.

42. 42 An example of this is near the centromeres of the Drosophila genome: If you look at the DNA sequence in this region it consists of small 5-10 bp sequences (AATAC)n repeated 1,000s of times. It is believed to have arisen from unequal crossing over. Repetitive DNA- cell does not like it- They try to reduce recombination of repetitive DNA by packaging the DNA with proteins to form heterochromatin- cold spots of recombination along the chromosome

43. 43 Duplications provide additional genetic material capable of evolving new function. For example in the above situation if the duplication for the B and C genes becomes fixed in the population- the additional copies of B and C are free to evolve new or modified functions. This is one explanation for the origin of the tandemly repeated globin genes in humans. Each of these has a unique developmental expression pattern and provides a specialized function. The hemoglobin in fetus has a higher affinity for oxygen since it acquires its oxygen from maternal hemoglobin via competition

44. 44 Two distinct globin chains (each with its individual heme molecule) combine to form hemoglobin. One of the chains is designated alpha. The second chain is called "non-alpha". The fetus has a distinct non-alpha chain called gamma. After birth, a different non-alpha globin chain, called beta, pairs with the alpha chain. The combination of two alpha chains and two non-alpha chains produces a complete hemoglobin molecule. The genes that encode the alpha globin chains are on chromosome 16. Those that encode the non-alpha globin chains are on chromosome 11. The alpha gene complex is called the "alpha globin locus", The non-alpha complex is called the "beta globin locus". The expression of the alpha and non-alpha genes is closely balanced by an unknown mechanism. Balanced gene expression is required for normal red cell function. Disruption of the balance produces a disorder called thalassemia. The closely linked globin genes may have originally arisen from tandem duplication.

45. 45 Alternatively some duplicated genes accumulate mutations and are no longer expressed (these are akin to junked cars along the highway). These are known as pseudogenes. One of the genes in the hemoglobin cluster is a pseudogene.  -G  -A  -  *-  -  pseudogene Unequal crossing over among the tandemly repeated hemoglobin gene cluster is the explanation for some inherited blood diseases. Hemoglobin lepore

46. 46 Alternatively some duplicated genes accumulate mutations and are no longer expressed (these are akin to junked cars along the highway). The beta-globin gene cluster in humans contains 6 genes, called epsilon (an embryonic form), gamma-G, gamma-A (the gammas are fetal forms), pseudo-beta-one (an inactive pseudogene), delta (1% of adult beta-type globin), and beta (99% of adult beta-type globin. Gamma-G and gamma-A are very similar, differing by only 1 amino acid. These are known as pseudogenes. One of the genes in the hemoglobin cluster is a pseudogene.  -G  -A  -  *-  -  pseudogene Unequal crossing over among the tandemly repeated hemoglobin gene cluster is the explanation for some inherited blood diseases. Hemoglobin lepore anemia  -G  -A  -  -   -G  -A  -  -   -G  -A  -

47. 47 If mispairing in meiosis occurs, followed by a crossover between delta and beta, the hemoglobin variant Hb-Lepore is formed. This is a gene that starts out delta and ends as beta. Since the gene is controlled by DNA sequences upstream from the gene, Hb-Lepore is expressed as if it were a delta. That is, it is expressed at about 1% of the level that beta is expressed. Since normal beta globin is absent in Hb-Lepore, the person has severe anemia. ***

48. 48 Inversion Chromosomes in which two breaks occur and the resulting fragment is rotated 180 degrees and reinserted into the chromosome. Inversions involve no change in the amount of genetic material and therefore they are often genetically viable and show no abnormalities at the phenotypic level. Gene fusions may occur Inversions are defined as to whether they span the centromere Pericentric inversions span the centromere: ABCDEABCDE ABDCEABDCE ACBDEACBDE In a pericentric inversion one break is in the short arm and one in the long arm. Therefore an example might read 46,XY,inv(3)(p23q27). A paracenteric inversion does not include the centromere and an example might be 46,XY,inv(1)(p12p31). Paracentric inversions do not span the centromere:

49. 49 Homologs which are heterozygous for an inversion have difficulties pairing in meiosis. During pairing homologous regions associate with one another. Consequently individuals heterozygous for an inversion will form a structure known as an inversion loop. Crossover within inverted region? A---B---C---D---E---F---G A’--B’---C’---D’--E’---F’---G’ ABC FG DE A’B’C’ ‘FG’ D’E’ A---B---C---D---E---F---G A’--B’---C’---E’---D’--F’---G’

50. 50 The consequence of crossover within a paracentric inversion a-b-cd-ef-ga-b-ce-df-ga-b-cf-g d-e During meiosis, pairing leads to formation of an inversion loop This is a problem if crossing over occurs within the inversion A-B-0-C-D-E’-C’--0--B’-A’dicentric-fragmentation G-F-E-D’-F’-G’acentric- no segregation AB C FG DE A’B’ C’ ‘FG’ D’E’

51. 51 a-b-cf-g During meiosis, pairing leads to formation of an inversion loop This is a problem if crossing over occurs within the inversion A-B-C-D-0-E’-C’-B’-A’fragment G-F-E-0-D’-F’-G’fragment The consequence of crossover within a pericentric inversion (one that spans the centromere). a-b-cd-ef-g d-e a-b-ce-df-g ABC FG DE A’B’C’ ‘FG’ D’E’

52. 52 Paracentric inversion crosses over with a normal chromosome, the resulting chromosomes are an acentric, with no centromeres, and a dicentric, with 2 centromeres. The acentric chromosome isn't attached to the spindle, so it gets lost during cell division, and the dicentric is usually pulled apart (broken) by the spindle pulling the two centromeres in opposite directions. These conditions are lethal. Pericentric inversion crosses over with a normal chromosome, the resulting chromosomes are duplicated for some genes and deleted for other genes. (They do have 1 centromere apiece though). The gametes resulting from these do not produce viable progeny. Thus, either kind of inversion has lethal results when it crosses over with a normal chromosome. The only offspring that survive are those that didn't have a crossover or crossed over in regions outside the inversion. Thus when you count the offspring you only see the non- crossovers, so it appears that crossing over has been suppressed.

53. 53 What are the consequences of crossing-over in an individual homozygous for an inversion? Genotype for normal individual AB0CDEFGAB0CDEFG AB0CDEFGAB0CDEFG Genotype of an individual heterozygous for an inversion: AB0CDEFGAB0CDEFG AB0CFEDGAB0CFEDG Genotype of an individual homozygous for an inversion: AB0CFEDGAB0CFEDG AB0CFEDGAB0CFEDG

54. 54 Translocations A segment from one chromosome is exchanged with a segment from another chromosome. Chromosome 1 ABCDEFABCDEF ----------------------0----------------------- ABCDEFABCDEF Chromosome 2 OPQRSTOPQRST ----------------------0----------------------- OPQRSTOPQRST Reciprocal translocation ABCDSTABCDST ----------------------0----------------------- OPQREFOPQREF This is more specifically called a reciprocal translocation and like inversions (and unlike duplications and deficiencies) no genetic material is gained or lost in a reciprocal translocation. Non-reciprocal translocations may also occur

55. 55 long arms of chromosome 7 and 21 have broken off and switched places. So you can see a normal 7 and 21, and a translocated 7 and 21. This individual has all the material needed, just switched around (translocated), so they should have no health problems. However there can be a problem when this person has children. Remember that when the gametes are made, each parent gives one of each chromosome pair. What would happen if this person gave the normal seven and the 21p with 7q attached? There are three copies of 7q instead of two. And there is only one copy of 21q t(11;18)(q21;q21) translocation between chromosomes 11 and 18 at bands q21 and q21 Philadelphia chromosome: t(9;22)(q34;q11).

56. 56 As with inversions, individuals heterozygous for a reciprocal translocation will exhibit abnormalities in chromosome pairing Notice this individual has the normal amount of genetic material (two copies of each gene). However it is rearranged. If the translocated fragment contains a centromere, you could get dicentri and acentric chromosomes How will translocated chromosomes pair in meiosis? ABCDEF ----------------------0----------------------- OPQRST ----------------------0----------------------- ABCDST ----------------------0----------------------- OPQREF

57. 57 These chromosomes will follow Mendel's rule of independent of assortment. In this instance one must focus on the centromere There are three possible patterns of segregation. ABCD E F ABCD S T S T RQPO N1 E F RQPO T1 T2 N2 Homologous regions associate with one another. Normal Pairing of 10 chromosomes in maize Chr8-9 translocation

58. 58 Alternate segregation: ｷ N1 and N2 segregate to one pole ｷ T1 and T2 segregate the other pole These gametes have the normal haploid gene content: one copy of each gene and are normal Adjacent segregation: ｷ N1 and T1 segregate to one pole ｷ T2 and N2 segregate to the other pole These gametes are anueploid: they are missing some genes and duplicated for other genes. Adjacent segregation ｷ N1 and T2 segregate to one pole ｷ N2 and T1 segregate to one pole Therefore, in a translocation heterozygote, some of the gametes are viable and some are inviable. ABCD E F ABCD S T S T RQPO N1 E F RQPO T1T1 T2T2 N2

59. 59 Reciprocal translocations result in genes that are known to map to different chromosomes but behave as linked genes. Under normal circumstances genes E and R assort independently because they are on different chromosomes. However in a translocation they will behave as closely linked genes and segregate together. ABCD E F ABCD S T S T RQPO N1 E F RQPO T1 T2 N2

60. 60 Translocations (and inversion) breakpoints sometimes disrupt an essential gene. That is the break occurs in the middle of a gene. In fact because of this, a number of specific translocations are causally associated with specific human cancers. The inherited disease Duchenne muscular dystrophy was mapped through a translocation that specifically disrupted this gene.

61. 61

62. 62 Glevec and the Philadelphia chromosome Abl is a tyrosine kinase. Function of the normal BCR gene product is not clear. In chronic myelogenous leukemia, the Philadelphia chromosome leads to a fusion protein of abl with bcr (breakpoint cluster region), termed bcr-abl. This is now a continuously active tyrosine kinase. Glevec inhibits the abl protein of cancer and non-cancer cells but cells normally have additional redundant tyrosine kinases which allow them to continue to function. Tumourogenesis however is entirely dependent on Bcr-Abl and so these cells get inactivated.

63. 63 abl/bcrFusion protein Chronic myelogenous and acute lymphotic leukemia ALK/NPM Fusion Large cell lymphomas HER2/neu Fusion Breast and cervical carcinomas MYH11/CBFB Fusion Acute myeloid leukemia ML/RAR Fusion Acute premyelocytic leukemia ERG/TMPRSS2Fusionprostate cancer Gene fusion -prostate cancer -ERG merges with a prostate- specific gene called TMPRSS2. ERG is a transcription factors