1. Copyright OpenHelix. No use or reproduction without express written consent1

2. Melina II A Web-Based Tool for Promoter Analysis Materials prepared by: Sawsan Khuri, Ph.D. www.openhelix.com Version 3.0

3. Copyright OpenHelix. No use or reproduction without express written consent3 Melina II Agenda Introduction and Credits Basic Searches Explanation of Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II: http://melina2.hgc.jp

4. Copyright OpenHelix. No use or reproduction without express written consent4 Introduction and Credits

5. Copyright OpenHelix. No use or reproduction without express written consent5 Melina II Credits algorithms references

6. Copyright OpenHelix. No use or reproduction without express written consent6 Melina II - Finding Help

7. Copyright OpenHelix. No use or reproduction without express written consent7 Melina II Agenda Introduction and Credits Basic Searches Summary of Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II: http://melina2.hgc.jp

8. Melina II - Where to Start Copyright OpenHelix. No use or reproduction without express written consent8 FASTA FORMAT: >GENE_1_ID and a few words accgtgggatggacgctgagctgaccaaagct agatcgaatatagactagcatgatcggataga >GENE_2_ID and a few words atatagcagtcgggatggacgctgagctgata gatcgatgctagtcgatagctgatgcta >GENE_3_ID and a few words atcgatggtgctgataacacgatgctgacgat gctagatcgatcgagcatgggatggacgctga gctgacatccgact ¶ ¶

9. Copyright OpenHelix. No use or reproduction without express written consent9 Melina II - Basic Searches

10. Copyright OpenHelix. No use or reproduction without express written consent10 Input Example

11. Copyright OpenHelix. No use or reproduction without express written consent11 Job Running Job ID

12. Sneak Preview of Results Copyright OpenHelix. No use or reproduction without express written consent12

13. Copyright OpenHelix. No use or reproduction without express written consent13 Melina II Agenda Introduction and Credits Basic Searches Explaining the Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II: http://melina2.hgc.jp

14. Copyright OpenHelix. No use or reproduction without express written consent14 Explaining the Algorithms - Consensus CONSENSUS: http://bifrost.wustl.edu/consensus/index.html

15. Copyright OpenHelix. No use or reproduction without express written consent15 Melina II - Consensus Parameters scroll

16. Copyright OpenHelix. No use or reproduction without express written consent16 Explaining the Algorithms - MEME MEME: http://meme.sdsc.edu/meme/intro.html

17. Copyright OpenHelix. No use or reproduction without express written consent17 Melina II - MEME Parameters

18. Copyright OpenHelix. No use or reproduction without express written consent18 Explaining the Algorithms - Gibbs Gibbs Motif Sampler: http://bayesweb.wadsworth.org/gibbs/gibbs.html

19. Melina II - Gibbs Parameters 19

20. Copyright OpenHelix. No use or reproduction without express written consent20 Explaining the Algorithms - MDscan MDscan: http://ai.stanford.edu/~xsliu/MDscan/

21. Melina II - MDscan Parameters 21

22. Copyright OpenHelix. No use or reproduction without express written consent22 Choosing the Method

23. Explaining the Algorithms - More Information CONSENSUS: http://bifrost.wustl.edu/consensus/index.html MEME: http://meme.sdsc.edu/meme/intro.html Gibbs Motif Sampler: http://bayesweb.wadsworth.org/gibbs/gibbs.html MDscan: http://ai.stanford.edu/~xsliu/MDscan/ 23

24. Copyright OpenHelix. No use or reproduction without express written consent24 Melina II Agenda Introduction and Credits Basic Searches Explaining the Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II: http://melina2.hgc.jp

25. Copyright OpenHelix. No use or reproduction without express written consent25 Understanding the Results - Left Hand Panel

26. Copyright OpenHelix. No use or reproduction without express written consent26 Understanding the Results - Summary View

27. Copyright OpenHelix. No use or reproduction without express written consent27 Understanding the Results - Navigation Tools

28. Copyright OpenHelix. No use or reproduction without express written consent28 Understanding the Results - the Zoom Tool

29. Copyright OpenHelix. No use or reproduction without express written consent29 Understanding the Results - the Fit Tool

30. Copyright OpenHelix. No use or reproduction without express written consent30 Understanding the Results - Lower Panel

31. Copyright OpenHelix. No use or reproduction without express written consent31 Understanding the Results - CONSENSUS clicked

32. Copyright OpenHelix. No use or reproduction without express written consent32 Understanding the Results - Gibbs Sequence Alignment Logo Diagram Further analysis clicked

33. Copyright OpenHelix. No use or reproduction without express written consent33 Understanding the Results - MDscan clicked Sequence Alignment Logo Diagram Further analysis

34. Copyright OpenHelix. No use or reproduction without express written consent34 Understanding the Results - MEME clicked

35. Copyright OpenHelix. No use or reproduction without express written consent35 Understanding the Results - Further Analysis

36. Copyright OpenHelix. No use or reproduction without express written consent36 Melina II Agenda Introduction and Credits Basic Searches Explaining the Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II: http://melina2.hgc.jp

37. Copyright OpenHelix. No use or reproduction without express written consent37 Sequence Alignment Logo Diagram Further analysis Motifs Choose parameters Results Input sequences Summary

38. Copyright OpenHelix. No use or reproduction without express written consent38 Melina II Agenda Introduction and Credits Basic Searches Explaining the Algorithms CONSENSUS MEME Gibbs Motif Sampler MDscan Understanding the Results Summary Exercises Melina II: http://melina2.hgc.jp

39. Copyright OpenHelix. No use or reproduction without express written consent39