1. a b Fig. S1 Expression constructs for Cas9 without DsRed gene, and Cas9 mRNA level in pZD_Cas9 transformed calli. a pZH_Cas9 without the DsRed expression cassette was used for the first transformation (TF 1 st ). pZK_gRNA targeted on the YSA locus was used for the second transformation (TF 2 nd ). b Cas9 mRNA levels normalized to the OsActin1 mRNA level are presented according to the ratio relative to line Cas9-#5. Data are the mean ±SD of three separate PCR analyses.

2. Fig. S2 Mutations detected in Cas9, gDsRed-3 double transformed calli at different time points. Representative sequences of mutant alleles identified from same transgenic line at 1 month and 2 months after pZK_gDsRed-3 transformation. The wild type sequence is shown at the top with the PAM sequence in green and the 20-nt target sequence in red. The blue arrowhead indicates the expected cleavage site. Dashes, deleted bases. The net change in length is noted to the right of each sequence (+, insertion; - deletion). The number of clones representing each mutant allele is shown in brackets. In 2-month- cultured cells after pZK_gDsRed-3 transformation, the 4 types of mutation shown at the top are the mutation patterns detected in cells cultured for 1 month. The five types of mutation at the bottom are the additional mutation patterns that were not detected at 1 month but that appeared in cells cultured for 2 months.

3. Fig. S3 Mutation frequency in pZH_Cas9 and pZK_gCDKB2 double transformed calli. CAPS analysis of the CDKB2 locus at different culture periods. Lines #1 - #6, independent pZK_gRNA targeted on CDKB2 locus (pZK_gCDKB2) transformed callus at 1 month and 2 months after pZK_gCDKB2 transformation. M, Marker; –RE, PCR product without restriction enzyme reaction; +RE, BsrGI-digested; -gRNA, pZH_Cas9 transformed calli without gRNA.

4. Target gene gRNA NameTarget sequence / PAM*Restriction Enzyme DsRedgDsRed-1GACCCAGGACTCCTCCCTGC / AGGPstI gDsRed-2GTGATGCAGAAGAAGACCAT / GGGNcoI gDsRed-3GTAGTAGCCGGGCAGCTGCA / CGGPvuII Young Seeding Albino (YSA) gYSAGCGCGCCACCTCGGCCGAAG / CGG†SfiI Cyclin-Dependent Kinase B2 (CDKB2) gCDKB2GACGTACGGGAAGGTGTACA / AGGBsrGI *Recognition sequences of restriction enzymes are underlined. † Target sequence used in Feng et al. (2013). Table S1 List of target genes and target sequences used in this study.

5. Table S2 Mutation frequency in pZH_Cas9 and pZK_gYSA double transformed calli at 1 month after pZK_gYSA transformation pZH_Cas9 transgenic line RCHMF(%) Mutation variations #15/1224-1,-2,+1(A),m1 #23/1812.5-1,+1(A,G) #34/233.2 #41/6N.D. #51/12N.D.

6. Table S3 Mutation frequency in pZH_Cas9 and pZK_gCDKB2 double transformed calli at different culture periods. gRNA Culture period after pZK2_gRNA transformation RCHMF 1 month2 months /1month 2months/ 1month RCHMF (%) Mutation variations RCHMF (%) Mutation variations gCDKB27/24N.D. 11/2421.3 -2,-17,-37 +1(G,T), m2 1.5721.3<