1. ©2001 Timothy G. Standish Hebrews 12:28 28Wherefore we receiving a kingdom which cannot be moved, let us have grace, whereby we may serve God acceptably with reverence and godly fear:

2. ©2001 Timothy G. Standish Transposons Timothy G. Standish, Ph. D.

3. ©2001 Timothy G. Standish Dynamic Genomes Many changes in the genetic material are known to be deleterious The more dramatic the change, in general the more catastrophic the outcome Thus rearrangements of DNA have traditionally been viewed as unnatural and dangerous things Discovery of transposons has given us a new far more dynamic perspective on genomes perspective on genomes within which segments of DNA naturally move about

4. ©2001 Timothy G. Standish Transposons And Evolution Much of the increase in genome size evident when simpler organisms are compared with more complex ones is attributed to gene duplication, some of which is attributed to transposons Transposons are also thought to have played a role in rearranging genomes P elements, a kind of transposon found in Drosophila, are thought to exhibit a mechanism for reproductive isolation and thus to play a role in evolution of new species

5. ©2001 Timothy G. Standish Basic Structure The simplest trasposons are called Insertion Sequences which are commonly found in bacteria Insertion sequences are named using the abbreviation IS followed by a number The location of an IS is given followed by a double colon then the insertion sequence name ::IS1 is IS1 located in the genome Transposon Inverted repeats (part of transposon) Genome Target sequence direct repeat Target sequence direct repeat

6. ©2001 Timothy G. Standish Transposase Mode of Insertion TGAATACTA ACTTATGAT Nick Target sequence Nick

7. ©2001 Timothy G. Standish T ACTTATGA GAATACTA T Mode of Insertion GGTAAT CCATTA ATTACC TAATGG Insertion sequence

8. ©2001 Timothy G. Standish T ACTTATGA GAATACTA T GGTAAT CCATTA ATTACC TAATGG Mode of Insertion CTTATGA GAATACT Insertion sequence Regular DNA repair machinery of the cell may take over, fill in gaps, repair nicks; thus completing incorporation of the IS Direct repeat Direct repeat

9. ©2001 Timothy G. Standish Overlap between Ins A and B Ins A Repressor? Ins B Transposase Inverted repeat The IS1 Sequence gaggtattattctcaggtaatgactccaacttactgatagtgttttatgttcagataatgcccg atgaccttgtcatgcagctccaccgattttgagaacgacagtgacttccgtcccagccttg ccagatgttgtctcagattcagattatgtcgctcaatgcgctgagtgtaacgcttgctgata acgtgcagctttcccttcaggcgtgattcatacagcggccagccatccgtcatccatacc acgacctcaaaggccgacagcaggctcagaagacgctccagtgtggccagagtgcg ttcaccgaagacgtgcgccacaaccgtcctccgtatcctgtcatacgcgtaaaacagcc agcgctgacgtgatttagcaccgacgtagccccactgttcgtccatttcagcgcagaca atcacatcactgcccggttgtatgcgcgaggttaccgactgcggcctgagttttttaagtga cgtaaaaccgtgttgaggccaacgcccataatgcgtgcactggcgcgacatccgacg ccattcatggccatatcaatgattttctggtgcttaccgggctgagaggcggtgtaagtga actgtagttgccatgttttacggcaaggagagcagagatagcgctgatgtccggcagtg cttttgccgttacgcaccacgccttcagtagcggagcaggaaggacatctgatggaaat ggaagccacgcaagcaccttaaaatcaccatcatacactaaatcagtaagttggcagc attacccactatcgtatggaat Overlap between Ins A and B Ins A Repressor? Ins B Transposase Inverted repeat

10. ©2001 Timothy G. Standish aug-ucg-cgc-cag-ugc-acg-cau-uau-ggg-cgu-ugg-ccu-caa-cac- ggu-uuu-acg-uca-cuu-aaa-aaa-cuc-agg-ccg-cag-ucg-gua-acc- ucg-cgc-aua-caa-ccg-ggc-agu-gau-gug-auu-guc-ugc-gcu-gaa- aug-gac-gaa-cag-ugg-ggc-uac-guc-ggu-gcu-aaa-uca-cgu-cag- cgc-ugg-cug-uuu-uac-gcg-uau-gac-agg-aua-cgg-agg-acg-guu- gug-gcg-cac-guc-uuc-ggu-gaa-cgc-acu-cug-gcc-aca-cug-gag- cgu-cuu-cug-agc-cug-cug-ucg-gcc-uuu-gag-guc-gug-gua-ugg- aug-acg-gau-ggc-ugg-ccg-cug-uau-gaa-uca- Met Ser Arg Gln Cys Thr His Tyr Gly Arg Trp Pro Gln His Gly Phe Thr Ser Leu Lys Lys Leu Arg Pro Gln Ser Val Thr Ser Arg Ile Gln Pro Gly Ser Asp Val Ile Val Cys Ala Glu Met Asp Glu Gln Tro Gly Tyr Val Gly Ala Lys Ser Arg Gln Arg Trp Leu Phe Tyr Ala Tyr Asp Arg Ile Arg Arg Thr Val Ala Thr Leu Glu Arg Leu Leu Ser Leu Leu Ser Ala Phe Glu Val Ala His Val Phe Gly Glu Arg Thr Leu Val Val Val Trp Met Thr Asp Gly Trp Pro Leu Tyr Glu Ser The Ins B Gene

11. ©2001 Timothy G. Standish