Presentation is loading. Please wait.

Presentation is loading. Please wait.

International Tomato Genome Sequencing Project 70 µm 0 µm 123 456789101112 108.0 Mb 85.6 Mb 83.6 Mb 82.1 Mb 80.0 Mb 53.8 Mb 80.3 Mb 64.7 Mb 81.8 Mb 88.5.

Published byElfreda Rogers Modified over 8 years ago

Similar presentations

Presentation on theme: "International Tomato Genome Sequencing Project 70 µm 0 µm 123 456789101112 108.0 Mb 85.6 Mb 83.6 Mb 82.1 Mb 80.0 Mb 53.8 Mb 80.3 Mb 64.7 Mb 81.8 Mb 88.5."— Presentation transcript:

1 International Tomato Genome Sequencing Project 70 µm 0 µm 123 456789101112 108.0 Mb 85.6 Mb 83.6 Mb 82.1 Mb 80.0 Mb 53.8 Mb 80.3 Mb 64.7 Mb 81.8 Mb 88.5 Mb 64.7 Mb 76.4 Mb 2426 191220271716101311 Mb T=220 246268274193120213277175164108135113 BACs T=2285 Euchromatin Heterochromatin To sequence Chromosome Country USAKoreaChinaUKIndiaNLFranceJapanSpainUSA Italy

2 University of Delhi South Campus Akhilesh K. Tyagi J. P. Khurana P. Khurana Arun Sharma National Research Centre for Plant Biotechnology Nagendra K. Singh T. Mohapatra T. R. Sharma K. Gaikwad National Centre for Plant Genome Research Debasis Chattopadhyay Sabhyata Bhatia Indian Initiative on Tomato Genome Sequencing Centromeric Region Heterochromatic Region Euchromatic Region Telomeric Region UDSC & NCPGR NRCPB (0-60 cM) (69-119 cM)

3 Criteria for BAC selection and confirmation 1.Selection of two candidate seed BACs on chromosome 5 specific marker 100 kb or more in size end sequence availability at SGN 4. BAC verification by direct sequencing using two marker/overlapping region-specific primers using vector-specific SP6 and T7 primers 2. Purity check of bacterial stock Hind III fingerprint of DNA isolated from six independent colonies 3. PCR amplification of genetic markers/overlapping region two marker/overlapping region-specific primer pairs 5. Size estimation/confirmation of BAC clone by CHEF analysis of Not I digested BAC DNA 6. Validation of BAC on chromosome 5 using Introgression Lines polymorphism in PCR products SNP detection of non-polymorphic bands

4 Confirmation of marker CT101 and its assigned seed BAC position on chromosome 5 Marker: CT101 Seed BAC: LE_HBa0191B01 Haplotype 1: -ACCCCTCAATATTTCGCTCCAA Haplotype 2: TGTATACTTGCGCCAGTTCAGGG L. esculentumL. pennelliiIL 5-1IL 5-2IL 5-3IL 5-4IL 5-5 Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, LE_HBa0191B01 Haplotype 2: L. pennellii, IL 5-1 (M82)

5 cMMarkerAmpli- con size HaplotypesSequence 0CT1011100 bp M82, IL5-2, IL5-3, IL5-4, IL5-5 -ACCCCTCAATATTTCGCTCCAA TGTATACTTGCGCCAGTTCAGGG L. pennellii, IL5-1 3T1252375 bp M82, IL5-2, IL5-3, IL5-4, IL5-5 GAATGAAT L. pennellii, IL5-1 7C2At1g602001000 bp M82, IL5-2, IL5-3, IL5-4, IL5-5 TAGATATGGT CTACCGA-AC L. pennellii, IL5-1 10 cLET-8-B23 (BAC-specific, non-marker region) 360 bp M82, IL5-2, IL5-3, IL5-4, IL5-5 GGCT-TTTAA--ATCTGCATTI/DGTTTCAGCT...GACT AAAATCAAGGTTGCGGATGCC...ACCAT-ATCI/DAGTA L. pennellii, IL5-1 12T0876110 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5 GA--A AGTTG L. pennellii 15.5cLED-8-G31000 bp M82, IL5-2, IL5-3, IL5-4, IL5-5 CTCG...GTTTT-...TGA-TAAGTTTGAAAGI/DAAGTI/DI/DATAA TGAAI/DACAAATI/DCTGGGGCACACTGGGA...GGAA......GACT L. pennellii, IL5-1 Confirmation of markers and their assigned seed BAC positions on chromosome 5

6 BAC/MarkerAmplicon size HaplotypesSequence LE_HBa0179K09 SP6 ext. 750 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0077G20 TACGTG...TTATGACT CGAACAI/DGACAATAG L. pennellii, IL7-2 T0876 110bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09 GA--A AGTTG L. pennellii, IL7-2 LE_HBa0179K09 T7 ext. 550 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0077G20 ACC GTA L. pennellii, IL7-2 SL_MboI0032F07 SP6 ext. 700 bp M82, IL5-1, IL5-2, IL5-3, IL5-4, IL5-5, LE_HBa0179K09, SL_MboI0032f07 TCTC...TC...GG...AGTG-TGGAAG ATCAI/DCAI/DTAI/DGA-AT-TTTCA L. pennellii, IL7-2 Reallocation of marker T0876 and its associated BAC positions on chromosome 7

7 Single streak of BAC clones from seed BAC library DNA extraction PCR with genetic marker for re-confirmation CHEF-analysis for size estimation Shotgun cloning and sequencing Searching for STCs (Sequence Tag Connector) SGN end-sequence database DNA fingerprinting (HindIII-digested) for BAC stock purity The path for genomic sequencing

8 The selected seed BACs and extension BACs cMMarkerClones selectedStatus 0 3 7 10 15.5 21 73 105 107 108 111 115 119 LE_HBa0191B01 LE_HBa0051A13 LE_HBa0261K11 LE_HBa0042B19 LE_HBa0179E24 LE_HBa0027B05 LE_HBa0169M21 LE_HBa0166A02 LE_HBa0040C21 LE_HBa0131D04 LE_HBa0006N20 LE_HBa0239D11 LE_HBa0245E05 119 LE_HBa0251J13 T1632 CT101 C2-At1g60200 cLET-8-B23 cLED-8-G3 BS4 T1360 T1777 T1541 T1584 TG69 CT130 TG597 TG185 Centromeric Region Heterochromatic Region Euchromatic Region Telomeric Region Long Arm Short Arm UDSC & NCPGR NRCPB LE_HBa0108A18 Phase II Phase III Phase I Phase II Phase III Phase I Phase II Phase I 16 LE_HBa0058L13 T1592 Library 79LE_HBa0334K22cLEX-13-G5 Phase I 84 LE_HBa0227B07 T1746 Library LE_HBa0168B11Phase II SL_MboI0037H06 Phase II SL_MboI0005B15Phase II Phase ISL_MboI0050C14 Phase II LE_HBa0106O06 SL_MboI0111D17 SL_EcoRI0086I08 SL_EcoRI0053P22 Sequencing LE_HBa0189E17 Phase III T0564 11 LE_HBa0074A13 LE_HBa0195M17 LE_HBa0051A18 SL_MboI0095J08Sequencing Library Phase I Library Phase II Phase I T1252 4 C2-At1g60440 0

9 SP6 T7 SP6 T7 SP6 T7 HBa0179K09 (108 kb) MboI0032F07 (~140 kb) MboI0052O23 MboI0083J01 MboI0077G20 (92 kb) SP6 9002 bp overlap (100%) 12955 bp overlap (100%) HBa0188L22 HBa0064M20 HBa0102G23 HBa0123J08 HBa0144B20 ~3.5 kb overlap ~1.4 kb overlap Primer pair 1 Primer pair 2 Primer pair 1 Primer pair 2 ~19 kb overlap ~15.5 kb overlap Chromosome 7 T1401 (COS) CT223 (RFLP) 95 cM Clones sequenced to Phase III level Clones sequenced to Phase II level Extension clones verified Red bars indicate the PCR positive nature of BAC clones using respective primer pairs Dotted line indicates the expected overlap Green line shows the presence of mapped markers on the BAC clones BACs mapped on chromosome 7

10 Gene prediction & annotation of some sequenced BAC clones BAC cloneKnownPutativeUnknownHypotheticalNo. of genes HBa0006N20443516 HBa00239D114113321 HBa0108A185641227 HBa0131D04493016 HBa0168B11 2822 14 HBa0169M21382316 HBa0334K2214038 HBa0245E052124321 HBa0166A02176115 HBa0040C21281718 HBa0251J13183012 Total29853139184

11 Important genes present on some BAC clones S. No.BAC cloneName of the geneOrganism 1HBa0191B01Putative cytochrome P450O. sativa 2HBa0191B01HAC1 transcription factorA. thaliana 3HBa0191B01UDP- glycosyl transferaseA. thaliana 4HBa0261K11Putrescine aminopropyltransferaseL. esculentum 5HBa0261K11 Splicing factor PWI containing protein/ RNA recognition motif L. esculentum 6HBa0261K11 Polygalactouranase isozyme 1 beta subunit precursor L. esculentum 7HBa0042B19Beta fructosidase geneL. pennellii 8HBa0042B19Nematode resistance-like protein (Gro1-6)S. tuberosum 9HBa0042B19 Peptide transporter PTR2-B A. thaliana 10SL_MboI0037H06 Potyviral capsid protein interacting protein 2a (CPIP2a) N. tabacum 11SL_MboI0037H06UV-damaged DNA binding protein 1 (hp1)L. cheesmanii 12SL_MboI0037H06VFNT cherry Pto locusL. esculentum 13HBa0179E24Tospovirus resistance protein C (Sw5-C)L. esculentum 14HBa0179E24Eukaryotic translation initiation factor 5A-3L. esculentum 15HBa0179E24ACS6 geneL. esculentum

12 Summary 5. Sequencing status of 25 BAC clones * Three BAC clones submitted to SGN/NCBI * One BAC clones in phase III (quality improvement) * Twelve BAC clones in phase II (10 submitted to NCBI) * Nine BAC clones in phase I 3. Finally, 31 BAC clones, covering approximately ~3.0 Mb region, have been mapped 2. Nine extension BAC clones from 6 nucleation points have been confirmed 1. Twenty two seed BAC clones using 20 markers have been confirmed 4. All BAC clones are being mapped on chromosome 5 by using chromosome 5- specific introgression lines 6. Two BAC clones from chromosome 7 have also been completely sequenced and submitted to SGN and NCBI

Download ppt "International Tomato Genome Sequencing Project 70 µm 0 µm 123 456789101112 108.0 Mb 85.6 Mb 83.6 Mb 82.1 Mb 80.0 Mb 53.8 Mb 80.3 Mb 64.7 Mb 81.8 Mb 88.5."

Similar presentations

Chr9 A ntonio Granell IBMCP-Valencia Spain Tomato Sequencing, Madison July 2006.

Chr9 A ntonio Granell IBMCP-Valencia Spain Tomato Sequencing, Madison July 2006.
The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.

The Role of Fluorescence in situ hybridization (FISH) in Sequencing the Tomato Genome.
9 Genomics and Beyond Brief Chapter Outline

9 Genomics and Beyond Brief Chapter Outline
PAA / Solanaceae 2006 - July 23-27, 2006 - Madison, Wisconsin, USA Sequencing the gene-rich space of tomato chromosome 7 Current status of the French effort.

PAA / Solanaceae July 23-27, Madison, Wisconsin, USA Sequencing the gene-rich space of tomato chromosome 7 Current status of the French effort.
Physical Mapping I CIS 667 February 26, 2004. Physical Mapping A physical map of a piece of DNA tells us the location of certain markers  A marker is.

Physical Mapping I CIS 667 February 26, Physical Mapping A physical map of a piece of DNA tells us the location of certain markers  A marker is.
Mining SNPs from EST Databases Picoult-Newberg et al. (1999)

Mining SNPs from EST Databases Picoult-Newberg et al. (1999)
Sequencing Tomato Chr9 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007 Antonio Granell IBMCP, Valencia.

Sequencing Tomato Chr9 Tomato Sequencing Meeting PAG XV 2007 San Diego, 14 January 2007 Antonio Granell IBMCP, Valencia.
Expanding the Tool Kit for BAC Extension Summary of completion criteria developed for NSF Tomato Sequencing Workshop January 14, 2007.

Expanding the Tool Kit for BAC Extension Summary of completion criteria developed for NSF Tomato Sequencing Workshop January 14, 2007.
Integrated Physical and Genetic Mapping of Upland Cotton Lei E Presented by Mingxiong PANG.

Integrated Physical and Genetic Mapping of Upland Cotton Lei E Presented by Mingxiong PANG.
Sequencing the Euchromatic Region of Chromosome 5 of Tomato.

Sequencing the Euchromatic Region of Chromosome 5 of Tomato.
Tomato Chromosome 2 PAG 2009 Doil Choi, Korea. Summary of chromosome 2 sequencing 142 cM 129cM CNR (?) 13.0 40.048.0 78.0100.0120.0 142.0 Markers (cM)

Tomato Chromosome 2 PAG 2009 Doil Choi, Korea. Summary of chromosome 2 sequencing 142 cM 129cM CNR (?) Markers (cM)
Compartmentalized Shotgun Assembly ? ? ? CSA Two stated motivations? ?

Compartmentalized Shotgun Assembly ? ? ? CSA Two stated motivations? ?
Tomato Chromosome 8 sequencing at Kazusa DNA Research Institute Erika Asamizu.

Tomato Chromosome 8 sequencing at Kazusa DNA Research Institute Erika Asamizu.
Human Genome Project Seminal achievement. Scientific milestone. Scientific implications. Social implications.

Human Genome Project Seminal achievement. Scientific milestone. Scientific implications. Social implications.
Genome of Drosophila species Olga Dolgova UAB Barcelona, 2008.

Genome of Drosophila species Olga Dolgova UAB Barcelona, 2008.
20.1 – 1 Look at the illustration of “Cloning a Human Gene in a Bacterial Plasmid” (Figure 20.4 in the orange book). If the medium used for plating cells.

20.1 – 1 Look at the illustration of “Cloning a Human Gene in a Bacterial Plasmid” (Figure 20.4 in the orange book). If the medium used for plating cells.
Presentation on genome sequencing. Genome: the complete set of gene of an organism Genome annotation: the process by which the genes, control sequences.

Presentation on genome sequencing. Genome: the complete set of gene of an organism Genome annotation: the process by which the genes, control sequences.
Mouse Genome Sequencing

Mouse Genome Sequencing
SOL Genomics Network Formed in 2003 to answer two questions: – How can a common set of genes give rise to such a wide range of morphologically and ecologically.

SOL Genomics Network Formed in 2003 to answer two questions: – How can a common set of genes give rise to such a wide range of morphologically and ecologically.
20.1 – 1 Look at the illustration of “Cloning a Human Gene in a Bacterial Plasmid” (Figure 20.4 in the orange book). If the medium used for plating cells.

20.1 – 1 Look at the illustration of “Cloning a Human Gene in a Bacterial Plasmid” (Figure 20.4 in the orange book). If the medium used for plating cells.

Similar presentations

Ads by Google