1. Biotechnology
Methods of working with DNA started in the 1970s. A key accomplishment was the invention of techniques for making recombinant DNA- these are DNA molecules formed when segments from two different sources are combined.

2. DNA Cloning: An Overview
Cell containing gene of interest
Bacterium 1
Gene inserted into plasmid
Bacterial chromosome
Plasmid
Gene of interest
Recombinant DNA (plasmid)
DNA of chromosome 2 2
Plasmid put into bacterial cell
Scientists needed methods to isolate small portions of a chromosome. Cloning is used to study specific genes.
Recombinant bacterium
Gene cloning involves using bacteria to make multiple
copies of a gene

3. Recombinant bacterium
Fig. 20-2b
Recombinant bacterium 3
Host cell grown in culture to form a clone of cells containing the “cloned” gene of interest
Gene of Interest
Protein expressed by gene of interest
Copies of gene
Protein harvested 4
Basic research and various applications
Basic research on gene
Basic research on protein
Cloning is useful for 2 purposes: 1) to make many copies of a particular gene; and 2) to create a protein product.
A protein with medical uses such as human growth hormone can be made in large quantities from cultures of bacteria carrying the cloned gene for the protein.
Gene for pest resistance inserted into plants
Gene used to alter bacteria for cleaning up toxic waste
Protein dissolves blood clots in heart attack therapy
Human growth hor- mone treats stunted growth

4. Restriction Enzymes
Gene cloning was made possible by the discovery of restriction enzymes.
Many different enzymes exist
named after the organism in which they are found
EcoRI (E. coli), HindIII (Haemophilus influenza), PstI (Providencia stuartii)

5. Restriction enzyme cuts sugar-phosphate backbones.
Fig
Restriction site
DNA 5 3 3 5 1
Restriction enzyme cuts sugar-phosphate backbones.
Sticky end
Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA

6. Restriction enzyme cuts sugar-phosphate backbones.
Fig
Restriction site
DNA 5 3 3 5 1
Restriction enzyme cuts sugar-phosphate backbones.
Sticky end 2
DNA fragment added from another molecule cut by same enzyme. Base pairing occurs.
Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA
One possible combination

7. Restriction enzyme cuts sugar-phosphate backbones.
Fig
Restriction site
DNA 5 3 3 5 1
Restriction enzyme cuts sugar-phosphate backbones.
Sticky end 2
DNA fragment added from another molecule cut by same enzyme. Base pairing occurs.
Figure 20.3 Using a restriction enzyme and DNA ligase to make recombinant DNA
This is how DNA is inserted into plasmids
One possible combination 3
DNA ligase seals strands.
Recombinant DNA molecule

8. DNA fragments from genomic DNA or cDNA or copy of DNA obtained by PCR
Fig. 20-UN3
DNA fragments from genomic DNA or cDNA or copy of DNA obtained by PCR
Vector
Cut by same restriction enzyme, mixed, and ligated
A complete set of recombinant plasmids, each carrying copies of a particular segment from the initial genome can be stored as a genomic library. There are various other cloning systems, but this is really the general idea.
Recombinant DNA plasmids

9. molecules; 2 molecules (in white boxes) match target sequence
Amplifying DNA in Vitro:
The Polymerase Chain Reaction (PCR) 5 3
TECHNIQUE
Target sequence
Genomic DNA 3 5
PCR can make billions of a
specific DNA segment in
a few hours. 1
Denaturation 5 3 3 5 2
Annealing
Cycle 1 yields 2
molecules
Primers 3
Extension
New nucleo- tides
Cloning is great for large quantities of a particular gene. But PCR is much more sensitive and is able to make large quantities of smaller DNA fragments when the DNA is in very small quantities (like looking for a needle in a haystack) or when the DNA is impure.
A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules.
Cycle 2 yields 4
molecules
Cycle 3 yields 8
molecules; 2 molecules (in white boxes) match target sequence

10. PCR produces many copies of a specific target segment of DNA
The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA
PCR Animation

11. PCR DNA Amplification

12. PCR Applications 30,000 y. o. woolly mammoth
Devised in 1985, PCR has had a huge impact on biological research and technology.
In forensics, PCR requires only small
samples of DNA to analyze

13. DNA polymerase (Taq)
The key to PCR was the discovery of an unusual DNA polymerase isolated from a bacterium (Thermus acquaticus) living in hot springs- this enzyme could withstand the temperatures necessary to separate DNA at the beginning of the cycle.

14. Gel Electrophoresis One indirect method of rapidly
Fig. 20-9
Mixture of DNA mol- ecules of different sizes
Power source
Longer molecules
Shorter molecules
Gel
Anode
Cathode
TECHNIQUE
RESULTS 1 2 + –
Gel Electrophoresis
One indirect method of rapidly
analyzing and comparing genomes
is gel electrophoresis
Figure 20.9 Gel electrophoresis

15. TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT
human genome
In 1995, an entire bacterial genome was sequence – 1.8 milliion base pairs. A mere 12 years later, sequencing technology had advanced so far that the human genome was completed by 2007

16. DNA Sequencing Relatively short DNA fragments
Fig
DNA (template strand)
TECHNIQUE
RESULTS
DNA (template strand)
DNA polymerase
Primer
Deoxyribonucleotides
Shortest
Dideoxyribonucleotides (fluorescently tagged)
Labeled strands
Longest
Shortest labeled strand
Longest labeled strand
Laser
Direction of movement of strands
Detector
Last base of longest labeled strand
Last base of shortest labeled strand
dATP
dCTP
dTTP
dGTP
ddATP
ddCTP
ddTTP
ddGTP
DNA Sequencing
Relatively short DNA fragments
can be sequenced using the dideoxy
chain termination method.
Figure Dideoxy chain termination method for sequencing DNA
Sequencing Video

17. DNA Sequencing

18. DNA Sequencer

19. New approaches have accelerated the pace of genome sequencing
The most ambitious mapping project to date has been the sequencing of the human genome
Officially begun as the Human Genome Project in 1990, the sequencing was largely completed by 2003
The project had three stages: Genetic (or linkage) mapping; Physical mapping; DNA sequencing
The Human Genome Project
was proposed in
1986 to determine the normal
sequence of all human DNA.

20. The history of sequencing
New Generation Sequencing
Millions of different fragments are
sequenced at the same time.
This is called massively parallel sequencing.
It is fully automated and miniaturized. It is an inexpensive way to sequence large genomes.

21. Studying the Expression of Interacting Groups
of Genes
DNA microarray assays compare patterns of
gene expression in different tissues, at different times,
or under different conditions
Microarray Video
50 µm
Automation has allowed scientists to measure expression of thousands of genes at one time using DNA microarray assays

22. Genetic diversity is explored without isolating intact organisms.
Metagenomics
Genetic diversity is explored without isolating intact organisms.
From: National Academy of Science, 2009

23. Cloning organisms has the potential to generate stem cells for research
Organismal cloning produces one or more organisms genetically identical to the “parent” that donated the single cell

24. Can a differentiated plant cell develop into a whole plant?
Fig
EXPERIMENT
Transverse section of carrot root
2-mg fragments
Fragments were cultured in nu- trient medium; stirring caused single cells to shear off into the liquid.
Single cells began to divide.
Embryonic plant developed from a cultured single cell.
Plantlet was cultured on agar medium and
later, planted in soil.
A single somatic carrot cell developed into a mature carrot plant.
RESULTS
Whole plants have been cloned from single differentiated cells since the 1950s
In plants mature cells can de-differentiate and then give rise to all cell types. Any cell with this potential is called totipotent.

25. Can the nucleus from a differentiated animal cell direct development
of an organism?
Fig
EXPERIMENT
Less differ- entiated cell
RESULTS
Frog embryo
Frog egg cell UV
Donor nucleus trans- planted
Frog tadpole
Enucleated
egg cell
Egg with donor nucleus
activated to begin
development
Fully differ-
entiated
(intestinal) cell
Donor
nucleus
trans-
planted
Most develop
into tadpoles
Most stop developing
before tadpole stage
Experiments with frog embryos have shown that a transplanted nucleus can often support normal development of the egg
Would you infer that differentiated animal cells are totipotent? (NO!)

26. Reproductive cloning of a mammal by nuclear transplantation
TECHNIQUE
Mammary cell donor
RESULTS
Surrogate mother
Nucleus from mammary cell
Cultured mammary cells
Implanted in uterus of a third sheep
Early embryo
Nucleus removed
Egg cell donor
Embryonic development
Lamb (“Dolly”) genetically identical to mammary cell donor
Egg cell from ovary
Cells fused
Grown in culture 1 3 4 5 6 2
Reproductive cloning of a mammal
by nuclear transplantation
In 1997, Scottish researchers
announced the birth of Dolly
In 1997, Scottish researchers announced the birth of Dolly, a lamb cloned from an adult sheep by nuclear transplantation from a differentiated mammary cell
Dolly’s premature death in 2003, as well as her arthritis, led to speculation that her cells were not as healthy as those of a normal sheep, possibly reflecting incomplete reprogramming of the original transplanted nucleus

27. CC (for Carbon Copy) was the first cat cloned
Fig
CC (for Carbon Copy) was the first cat cloned
Since 1997, cloning has been demonstrated in many mammals, including mice, cats, cows, horses, mules, pigs, and dogs
CC (for Carbon Copy) was the first cat cloned; however, CC differed somewhat from her female “parent

28. The practical applications of DNA technology
Many fields benefit from DNA technology and genetic engineering

29. From bone marrow in this example
Cultured stem cells
Early human embryo at blastocyst stage (mammalian equiva- lent of blastula)
Different culture conditions
Different types of differentiated cells
Blood cells
Nerve cells
Liver cells
Cells generating all embryonic cell types
Adult stem cells
Cells generating some cell types
Embryonic stem cells
From bone marrow in this example
A stem cell is a relatively unspecialized
cell that can reproduce itself indefinitely
and differentiate into specialized cells
of one or more types
Stem cells isolated from early embryos at the blastocyst stage are called embryonic stem cells; these are able to differentiate into all cell types. Can repair damaged or diseased organs.
Stem cell animation
Nuclear implantation

30. Gene therapy Cloned gene
Fig
Bone marrow
Cloned gene
Bone marrow cell from patient
Insert RNA version of normal allele into retrovirus.
Retrovirus capsid
Viral RNA
Let retrovirus infect bone marrow cells that have been removed from the patient and cultured.
Viral DNA carrying the normal allele inserts into chromosome.
Inject engineered cells into patient. 1 2 3 4
Gene therapy
Figure Gene therapy using a retroviral vector
Gene therapy holds great potential for treating disorders traceable to a single defective gene

31. Genetic engineering in plants has been used to transfer many
Fig
TECHNIQUE
Genetic engineering in plants
has been used to transfer many
useful genes
Agrobacterium tumefaciens
Ti plasmid
Site where restriction enzyme cuts
T DNA
RESULTS
DNA with the gene of interest
The Ti plasmid is the most commonly used vector for introducing new genes into plant cells
Genetic engineering in plants has been used to transfer many useful genes including those for herbicide resistance, increased resistance to pests, increased resistance to salinity, and improved nutritional value of crops
Recombinant Ti plasmid
Plant with new trait

32. Plant Breeding compared to Genetic Modification of Plants

33. GHOSTS

34. Fig
TECHNIQUE
Heavy weight
Restriction fragments
DNA + restriction enzyme
I II III
Nitrocellulose membrane (blot)
Gel
Sponge
I Normal -globin allele
II Sickle-cell allele
III Heterozygote
Paper towels
Alkaline solution 1
Preparation of restriction fragments 2
Gel electrophoresis 3
DNA transfer (blotting)
Radioactively labeled probe for -globin gene
Figure Southern blotting of DNA fragments- this method combines gel electrophoresis with something called nucleic acid hybridization. Because there are too many bands to distinguish, scientists use a radioactive single stranded DNA complementary to the gene of interest. The probe will only recognize and bond with the gene of interest.
Probe base-pairs with fragments
I II III
I II III
Fragment from sickle-cell -globin allele
Film over blot
Fragment from normal -globin allele
Nitrocellulose blot 4
Hybridization with radioactive probe 5
Probe detection