Download presentation
Presentation is loading. Please wait.
1
Cell Surface Targeting
7/24/06
2
Adaptamers
3
Questions Can we observe a gel shift with the conditions we’re using?
If so, are our aptamers binding protein?
4
Answers Yes, we can observe streptavidin binding biotin.
No, neither of our aptamers appear to bind their targets. But we’re pretty sure of the reason.
5
(Very) High Concentrations
T5: thrombin aptamer + 5 nts S5: streptavidin aptamer + 5 nts Protein staining DNA staining Protein staining 2: .1% BSA 3: thrombin in .1% BSA 4: thrombin + T5 in .1% BSA 5: streptavidin + S5 6: streptavidin + S5 7: streptavidin + biotinylated oligos DNA staining 9: biotinylated oligos 10: biotinylated oligos + streptavidin 11: S5 12: S5 + streptavidin
6
Findings 1) Observation of streptavidin binding biotin.
Protein staining DNA staining Protein staining 2: .1% BSA 3: thrombin in .1% BSA 4: thrombin + T5 in .1% BSA 5: streptavidin + S5 6: streptavidin + S5 7: streptavidin + biotinylated oligos DNA staining 9: biotinylated oligos 10: biotinylated oligos + streptavidin 11: S5 12: S5 + streptavidin
7
Findings Observation of streptavidin binding biotin.
Streptavidin is not binding S5. Protein staining DNA staining Protein staining 2: .1% BSA 3: thrombin in .1% BSA 4: thrombin + T5 in .1% BSA 5: streptavidin + S5 6: streptavidin + S5 7: streptavidin + biotinylated oligos DNA staining 9: biotinylated oligos 10: biotinylated oligos + streptavidin 11: S5 12: S5 + streptavidin
8
Findings Observation of streptavidin binding biotin.
Streptavidin is not binding S5. BSA is actually responsible for bands in lanes with thrombin. Protein staining 2: .1% BSA 3: thrombin in .1% BSA 4: thrombin + T5 in .1% BSA 5: streptavidin + S5 6: streptavidin + S5 7: streptavidin + biotinylated oligos DNA staining 9: biotinylated oligos 10: biotinylated oligos + streptavidin 11: S5 12: S5 + streptavidin
9
Findings Observation of streptavidin binding biotin.
Streptavidin is not binding S5. BSA is actually responsible for bands in lanes with thrombin. Is there a thrombin shift? Unclear. Protein staining 2: .1% BSA 3: thrombin in .1% BSA 4: thrombin + T5 in .1% BSA 5: streptavidin + S5 6: streptavidin + S5 7: streptavidin + biotinylated oligos DNA staining 9: biotinylated oligos 10: biotinylated oligos + streptavidin 11: S5 12: S5 + streptavidin
10
Moderate Concentration
4) Thrombin shift? No. Protein staining DNA staining Protein staining 2: thrombin 3: thrombin + T5 4: streptavidin + S5 5: streptavidin + S5 6: streptavidin + biotinylated oligos DNA staining 8: nothing + loading dye 9: T5 10: T5 + thrombin 11: S5 12: S5 + streptavidin
11
Moderate Concentration
Question: What is responsible for these bands? Protein staining DNA staining Protein staining 2: thrombin 3: thrombin + T5 4: streptavidin + S5 5: streptavidin + S5 6: streptavidin + biotinylated oligos DNA staining 8: nothing + loading dye 9: T5 10: T5 + thrombin 11: S5 12: S5 + streptavidin
12
More answers Have been using bovine thrombin, not human thrombin.
Secondary structure issues: everyone else denatures their aptamers prior to incubation with protein
13
Next: Change the thrombin, add denaturation If it works,
try adaptamer experiments; also, redesign adaptamers to avoid secondary structure conflicts. Order aptamers that can bind a cell. If it doesn’t, Put on thinking cap.
15
Sequencing results Clones from Ting lab: StrepW, StrepH, StrepD
BioBrick’d and sent out for sequencing last week Results StrepW: Correct sequence from both forward/reverse reactions StrepH: One mutation at bp 344, T to C GCT to GCC, silent mutation for alanine StrepD: Correct sequence from forward reaction, correct sequence from reverse reaction Performed midipreps
16
BioBricks for Lpp-OmpA
OmpA PCR 46-66 100 1000 400 200 500 1650 46-159 full 300 Lpp PCR 100 400 200 500 300 1-29 full +stop XbaI/PstI digest Lpp 1-29 OmpA 46-66 46-159 100 400 200 500 300
17
BioBricks for SCD streptavidin
Single-chain dimer clones from Aslan lab SCD-NM C2 E2 E X StrepSCDF StrepSCDMF StrepSCDMR 1 825 S P StrepSCDR PstI site, 620 CTGCAG CTGCGG 100 400 200 500 300 SCD-NM C E2 MF/R F/MR F/R non-mut 650 850 1000 1st PCR 400 300 SCD-NM C E2 F/R Crossover PCR sent out for sequencing
18
Sequencing results Homology in bp regions ~1-250 and ~550-800 Why?
Single Chain Dimer Forward primer annealing region Bp : gaggccaacgccaagaagtc Bp : gaggccaacgcctggaagtc Explains double PCR products with F/MR and F/R primers Does not explain single crossover PCR product
19
Progress/plans Midipreps of StrepW, StrepH, StrepD
BioBricks of Lpp(1-29), OmpA(46-66) and (46-159); sent out for sequencing Confirm sequences of Lpp and OmpA parts; midiprep. Digest and assembly. Figure out solution for StrepSCD PCR Design new primers Anneal upstream on plasmid PCR in separate parts and assemble
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.