Download presentation
Presentation is loading. Please wait.
Published byGillian Johnson Modified over 8 years ago
1
Molecular markers Non-PCR based 1courtesy of Carol Ritland
2
Ideal properties for molecular markers Highly polymorphic Codominant (2N) Frequent in genome Selectively neutral Easily availability Highly reproducibility Easy to exchange between research groups 2
3
Genetic Jargons Terms –Locus = portion of DNA (plural = loci) Not always a gene –Allele = form that a locus can take: Mendelian Subjective depending on resolution of measurement –Nucleotide state difference (sequencing eg. SNPs) –Length difference (microsatellite) –Functional difference (ABO blood group) –Electrophoretic difference (allozyme) …AGGCGTTCGCTTATGATAA… …AGGCGTACGCTTATGATAA… …AGGCGTTCACACACACACGCTTATGATAA… …AGGCGTTCACACACACACACGCTTATGATAA… 3
4
RFLP Restriction Fragment Length Polymorphism ( Box 1.2 ) –Digestion of large amount (10ug) of genomic DNA using R.E. –Run digested fragments into agarose gel –Due to different R.E. sites the fragment lengths will differ –Require a “known” probe (0.5 to 3.0 kb) –Using Southern blot technique –Botstein et al. Am J. Hum Genet., 1980 32:314-331 4
5
Griffiths et al Introduction to genetics 1996 5
6
6
7
Sickle cell screening Single base change RE for CTGAGG Both parents are carrier Child 1 = affected Child 2 = carrier Child 3 = not affected Prenatal screening Saiki, RK; Scharf S, Faloona F, Mullis KB, Erlich HA, Arnheim N (Dec 20 1985). "Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia". Science 230 (4732): 1350–4.Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemiaScience 7
8
VNTR Variable Nuclear Tandem Repeat Minisatellites with repeats of 11 to 60 bp long Using RFLP method but probing with repeat probes (Southern Blot) Looking for fingerprint patterns Pending of RE used Scoring for number of bands Potential to have many allele in a population Dominant marker with Mendelian inheritance Jeffrey A. et al. 1985 Nature 314:67-73 8
9
VNTR Griffiths et al Introduction to genetics 1996 9
10
10
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.