1. Isolation and Characterization of the Metallothionein Promoter
in Artemia
HHMI Spring 2004
Gwen Jordaan

2. Background metallothionein = MT metal-binding protein
four isoforms identified in mammals: MT-I,
MT-II, MT-III and MT-IV
diverse functions -metal ion homeostasis
-heavy metal sequestration
-protection from oxidative damage
-metal reservoir
HHMI Spring 2004
Gwen Jordaan

3. Metallothionein dumbbell shape, cysteine-rich  domain and  domain
clusters of metal ions
HHMI Spring 2004
Gwen Jordaan

4. Metallothionein Zinc-thiolate clusters Eo very low
Fischer et al., Proc.Natl.Acad.Sci. 1998
Maret, W. Am.Soc.Nutr.Sci 2000
HHMI Spring 2004
Gwen Jordaan

5. Metallothionein Regulation
regulation – transcriptional level
induction – metals, oxidants,cytokines, hormones
metal induction- metal responsive elements (MREs)
MREs- conserved core sequence TGC(G/A)CNC
metal transcription factor, MTF-1 regulates expression
- binding to MRE
- activity induced by metals but needs zinc to bind
to MRE
HHMI Spring 2004
Gwen Jordaan

6. Metallothionein Regulation
HHMI Spring 2004
Gwen Jordaan

7. Artemia brine shrimp – Artemia salina Nauplius Adult
HHMI Spring 2004
Gwen Jordaan

8. Metallothionein Why Artemia?
small, easy to grow, and relatively cheap to purchase
embryonic development extensively studied
biomarker for heavy metal contamination in aquatic
ecosystems
-phthalate ester embryotoxicity
four Artemia MT isoforms identified
coding region of one of the isoforms sequenced
HHMI Spring 2004
Gwen Jordaan

9. Metallothionein Goal: isolate and sequence the promoter region, ID
position and number of MREs, and determine
extent of promoter activity when induced by
heavy metals
- experiment design will determine if four
isoforms regulated by one promoter, or if each
isoform is regulated by its own promoter
HHMI Spring 2004
Gwen Jordaan

10. Metallothionein coding sequence of Artemia MT isoform
5’ATGGACTGCTGCAAGAACGGTTGCACCTGTGCCCCAAATTGCAAATGTGCC
Start asp cys cys lys asn gly cys thr cys ala pro asn cys lys cys ala
AAAGACTGCAAATGCTGCAAAGGTTGTGAGTGCAAAAGCAACCCAGAATGC
lys asp cys lys cys cys lys gly cys glu cys lys ser asp pro glu cys
AAATGTGAGAAGAACTGTTCATGCAACTCATGTGGTTGTCACTGA3’
lys cys glu lys asn cys ser cys asn ser cys gly cys his Stop
HHMI Spring 2004
Gwen Jordaan

11. Methods and Materials Genomic DNA digested with restriction enzymes
DNA walking method- amplification of an unknown
sequence adjacent to a known sequence -
touchdown PCR – annealing/extension temperature is
higher than Tm of the primers
HHMI Spring 2004
Gwen Jordaan

12. Methods and Materials measure fluorescence DNA walking
Clone into vector clone into GFP
reporter gene
Send for sequencing
generate MT promoter-
ID MREs GFP constructs
transfect into COS cells
treat with nM metal concentrations
for 24h incubation
measure fluorescence
HHMI Spring 2004
Gwen Jordaan

13. Methods and Materials MT-GFP constructs showing deletions
MT-GFP vector
GFP
HHMI Spring 2004
Gwen Jordaan

14. Expected Results induction by Zn greater than Cd
extent of induction decreased as MREs removed
HHMI Spring 2004
Gwen Jordaan

15. Future Perspectives
4 promoters for 4 isoforms or 1 promoter for 4 isoforms
- expression is tissue-specific
- differential expression due to environmental factors
cooperative interaction among MREs
promoter sequenced other regulatory elements can be
identified and studied
-ARE/USF – oxidative stress
HHMI Spring 2004
Gwen Jordaan

16. Dr Acey (Research Mentor) HHMI Dr Mason (Instructor)
Acknowledgements
Dr Acey (Research Mentor)
HHMI
Dr Mason (Instructor)
HHMI Spring 2004
Gwen Jordaan