Presentation is loading. Please wait.

Presentation is loading. Please wait.

Dal GIST al K-RAS OVVERO Dall E.E. al D.N.A. Come è cambiata e sta cambiando lAnatomia Patologica Gallarate Aprile 2009.

Similar presentations


Presentation on theme: "Dal GIST al K-RAS OVVERO Dall E.E. al D.N.A. Come è cambiata e sta cambiando lAnatomia Patologica Gallarate Aprile 2009."— Presentation transcript:

1 Dal GIST al K-RAS OVVERO Dall E.E. al D.N.A. Come è cambiata e sta cambiando lAnatomia Patologica Gallarate Aprile 2009

2 Imatinib mesylate (also called Gleevec® or STI571) is approved by the U.S. Food and Drug Administration (FDA) for the treatment of some forms of adult and pediatric chronic myelogenous leukemia (CML), and for the treatment of a rare form of cancer called gastrointestinal stromal tumor (GIST).

3 Foto cd117 STI571

4 foto GLEEVEC

5 Foto cml

6 Foto gist

7

8

9 MIB1

10 Alfa-actina

11

12 CD117

13 GastroIntestinal Stromal Tumors Acivating mutations in c-KIT and PDGFR A About 80-90% of patients show mutations * Antonescu RC, Clin Cancer Res 2005; 11: %

14 GastroIntestinal Stromal Tumors Acivating mutations in c-KIT and PDGFR A About 75% of GISTs shows mutations on exon 11 and are related to Imatinib sensitivity (>80% clinical response) About 75% of GISTs shows mutations on exon 11 and are related to Imatinib sensitivity (>80% clinical response) Fletcher JA and Rubin BP ; Current Opinion in Genetics & Development, 2007; 17: 3-7 About 10%- 15% of GISTs shows mutations on exon 9 and have an aggressive clinical behaviour About 10%- 15% of GISTs shows mutations on exon 9 and have an aggressive clinical behaviour

15 GastroIntestinal Stromal Tumors Imatinib or Sunitinib Resistance Antonescu RC, Clin Cancer Res 2005; 11: Heinrich MC, J.Clin. Oncol. 2006; 24: Antonescu RC, Clin Cancer Res 2005; 11: Heinrich MC, J.Clin. Oncol. 2006; 24: Mutations in exon 9 are generally associated to primary resistance Mutations in exon 13, 14 and 17 of c-KIT gene are subsequent to exon 11 mutations and are generally associated to acquired resistance Mutations in exon 13, 14 and 17 of c-KIT gene are subsequent to exon 11 mutations and are generally associated to acquired resistance

16 Mutazioni iniziali e secondarie Exon 9 Membrana cellulare Exon 11Exon 13Exon 17 Mutazioni inizialiMutazioni secondarie Resistenza secondaria CD117 Resistenza primaria GLEEVEC

17 Dr. Lei Chen and others at M.D. Anderson Cancer Center in Houston have identified a secondary mutation that occurs in KIT kinase domain 1 (exon 13). This secondary mutation correlates with resistance to Gleevec. Among the 130 patients in the M.D. Anderson study, 12 who had an excellent initial response were chosen for further study. Seven of these patients originally had exon 11 mutations and five had exon 9 mutations. Five of these patients developed resistance in a total of six tumors. In each case, in addition to the original exon 11 or exon 9 mutation, a new secondary exon 13 mutation, Val654Ala, was identified. In each of these cases, the secondary mutation was identical and the resistant tumors now contained both the primary mutation (exon 11 or exon 9) and the new exon 13 mutation. In the seven patients who did not develop resistance no secondary mutations were found.

18 Dalla diagnosi di LEIOMIOBLASTOMA a quella di GIST CD117 + Valutazione mutazioni esoni Parametri prognostici

19 GIST is a rare form of cancer BUT LUNG ? COLON ?

20

21 TAILOR AIFA TArceva Italian Lung Optimization tRial

22 Lo studio deve valutare se i casi di K polmonare non mutati per EGFR siano responsivi al Tarceva dando per acquisito che i mutati lo siano Siamo sicuri che tutti casi ( o almeno gli adenoK giovanili ) siano studiati per stato mutazionale di EGFR ? Quanti fanno sistematicamente una valutazione dello stato mutazionale di EGFR nel K polmonare ed in quali casi ?

23 EGF TGF Amphiregulin -cellulin HB-EGF Epiregulin Heregulins NRG2 NRG3 Heregulins -cellulin Cysteine-rich domains Tyrosine kinase domain ErbB-1 Her1 EGFR ErbB-2 Her2 neu ErbB-3 Her3 ErbB-4 Her4 C-terminus La famiglia HER (erbB) ed i suoi ligandi

24 Location of mutations in TK domain of EGFR gene del ELREA (E746-A750)

25 Exon 20 T790M Mechanisms of resistance to TK inhibitors Exon 19 del E745-A750

26 PARLIAMO DI K COLON E DI K-RAS CANCRO COLON-RETTO 90 CASI x 10 5 ANNUI IN LOMBARDIA 8000 CASI ANNUI RICADUTA CIRCA 4000 Pz

27 EGF TGF Amphiregulin -cellulin HB-EGF Epiregulin Heregulins NRG2 NRG3 Heregulins -cellulin Cysteine-rich domains Tyrosine kinase domain ErbB-1 Her1 EGFR ErbB-2 Her2 neu ErbB-3 Her3 ErbB-4 Her4 C-terminus La famiglia HER (erbB) ed i suoi ligandi CETUXIMAB HERCEPTIN

28

29 NESSUN RISULTATO ATTENDIBILE DIFFICOLTA TECNICHE DI RECUPERO ANTIGENICO NON RESPONSIVITA CASI POSITIVI ALLA IIC RESPONSIVITA CASI NEGATIVI ALLA IIC

30 Centr EGFR

31 COLON NORMALECARCINOMA -- POLISOMIA

32 Perdita materiale nucleare 2 green 2 red 4 green 4 red CELLULA NORMALE CELLULA TUMORALE 2 green 2 red

33 CARCINOMA – AMPLIFICAZIONE

34

35 APPROCCIO AUTOMATICO DI LETTURA

36

37

38 Gene copy number for epidermal growth factor receptor (EGFR) and clinical response to antiEGFR treatment in colorectal cancer: a cohort study M.Moroni, S.Veronese,S.Benvenuti, G.Marrapese,A. Sartore-Bianchi, F.Dinicolantonia,M.Gambacorta,S.Siena, A.Bardelli. Lancet Oncology 2005

39 EGFR gene copy number analysis EGFR/CEP 7 > 2,50 copies per cell Disomy PolysomyFocal amplification > 40% polysomic cells with > 3 EGFR copies

40 PFS and OS according to the proposed cut off values Sartore-Bianchi A et al. J Clin Oncol 2007

41 Clinical usefulness of EGFR gene copy number as a predictive marker in colorectal cancer patients treated with Cetuximab : A FISH study Personeni N. et Al Clin Cancer Res 2008 E in corso uno studio pluricentrico per standardizzazione tecnica e interpretazione risultati F.I.S.H. Her1 su sezioni

42 SEQUENZA E G F R : ASSENZA DI MUTAZIONI ESONI 18, 19, 20, 21

43 TK signaling cascade

44 Mutated KRAS is prevalent in many different tumor types Cancer Type Reported Incidence of Mutated KRAS Pancreatic72 – 90% Colon32 – 57% Lung15 – 50% Ovarian5 – 50% Gall bladder14 – 38% Multiple myeloma16 – 33% Adapted from: Friday BB and Adjei AA. Biochim. Biophys. Acta. 2005; 1756:

45 K-RAS Mutations …… GGA GCT GGT GGC GTA GGC …… Wild-type G12D G12S WT G12DGly12Asp GGT>GAT G12AGly12Ala GGT>GCT G12VGly12Val GGT>GTT G12SGly12Ser GGT>AGT G12RGly12Arg GGT>CGT G12CGly12Cys GGT>TGT G13DGly13Asp GGC>GAC

46 2008 ASCO Annual Meeting Gastrointestinal (Colorectal) Cancer KRAS status and efficacy in the first-line treatment of patients with mCRC treated with FOLFIRI with or without Cetuximab : the CRYSTAL experience Van Cutsem E et al; JCO 26; 2008 (May 20 Suppl; abstr 2) WT Patients (64.4%) Progression Free survival (PFS)p= Overall response (OS)p= archived tumor material KRAS mutated Patients (35.6%) Progression Free survival (PFS)p=0.75 Overall response in (OS)p=0.46 Conclusion : KRAS mutation status has a predictive value for treatment with FOLFIRI + Cetuximab in the first-line treatment of mCRC

47 KRAS status and efficacy of first-line treatment of patients with mCRC with FOLFOX with or without Cetuximab : the OPUS experience Bokemeyer C et al; JCO 26; 2008 (May 20 Suppl; abstr 4000) 233 tumor samples 99/233 (42.5%)KRAS mutated 134/233 (57.5%)KRAS WT PFS and overall Response Rate (RR) by KRAS mutation status KRAS status Median PFS (mo) Cetuximab + FOLFOX Median PFS (mo) FOLFOX Overall RR (%) Cetuximab + FOLFOX Overall RR (%) FOLFOX Wild-type7.7 (n=61)7.2 (n=73) HR = 0.57 p= (n=61)37 (n=73)p=0.01 Mutation5.5 (n=52)8.6 (n=47) HR = 1.83 p= (n=52)49 (n=47)p=0.11 HR : Hazard Ratio Conclusions: The benefit from addiction of Cetuximab to standard treatment is higher for KRAS WT population ASCO Annual Meeting Gastrointestinal (Colorectal) Cancer

48 Best response Ras/Raf mutations - + Total SD+PD1521 (58.3%) 36 PR101 (9.0%) 11 Total p =0.005 (Fisher's exact test) Logistic regression Odds Ratio = (CI 95% =(0.008, 0.619); p=0.017) Time To Progression according KRas and BRaf mutational status

49 MoAb Protein kinase BRaf mutations RAF Constitutive activation of EGFR effectors RAS

50 PTEN inactivation or loss of expression MoAb pAkt (Phosphatase and Tensin homolog deleted on chromosome 10)

51 v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog KRAS The KRAS gene is located on the short (p) arm of chromosome 12 at position 12.1.chromosome 12 More precisely, the KRAS gene is located from base pair 25,249,446 to base pair 25,295,120 on chromosome 12. ENSG Exons: 6 Transcript length: 5,419 bps Protein length: 189 residues gene 12p12.1

52 5' upstream sequence ………………… cccggccccgaactcatcggtgtgctcggagctcgattttcctaggcggc Exon 1 (170)GGCCGCGGCGGCGGAGGCAGCAGCGGCGGCGGCAGTGGCGGCGGCGAAGGTGGCG GCGGCTCGGCCAGTACTCCCGGCCCCCGCCATTTCGGACTGGGAGCGAGCGCGGCGCAGG CACTGAAGGCGGCGGCGGGGCCAGAGGCTCAGCGGCTCCCAGGTGCGGGAGAGAG Intron 1-2 (5355) gtacggagcg ttattataag Exon 2 (122)GCCTGCTGAAAATGACTGAATATAAACTTGTGGTAGTTGGAGCTGGTGGCGTAGG CAAGAGTGCCTTGACGATACAGCTAATTCAGAATCATTTTGTGGACGAATATGATCCAA CAATAGAG Intron 2-3 (17.861) gtaaatcttg cccttctcag Exon 3 (179)GATTCCTACAGGAAGCAAGTAGTAATTGATGGAGAAACCTGTCTCTTGGATATTCTC GACACAGCAGGTCAAGAGGAGTACAGTGCAATGAGGGACCAGTACATGAGGACTGGGG AGGGCTTTCTTTGTGTATTTGCCATAAATAATACTAAATCATTTGAAGATATTCACCATTATAG Intron 3-4 (1.460) gtgggtttaa tctttcccag Exon 4 (160)AGAACAAATTAAAAGAGTTAAGGACTCTGAAGATGTACCTATGGTCCTAGTAGGA AATAAATGTGATTTGCCTTCTAGAACAGTAGACACAAAACAGGCTCAGGACTTAGCAAGA AGTTATGGAATTCCTTTTATTGAAACATCAGCAAAGACAAGACAG Intron 4-5 (10.053) gtaagtaaca tacaatgcag Exon 5 (124)AGAGTGGAGGATGCTTTTTATACATTGGTGAGGGAGATCCGACAATACAGATTGA AAAAAATCAGCAAAGAAGAAAAGACTCCTGGCTGTGTGAAAATTAAAAAATGCATTATAA TGTAATCTG Intron 5-6 (5.525) gtaagtttaa tgtatttcag Exon 6 (4.664)GGTGTTGATGATGCCTTCTATACATTAGTTCGAGAAATTCGAAAACATAAAGAAAAGATG ……………………………………………………………………………………………………………………… 3' downstream sequence actatgagtgtgtatttattcatgaaatttgaactgtttgccccgaaatg KRAS gene

53

54 Gene NameSample Number Positive Samples Percent Mutated KRAS % APC % BRAF % CTNNB % PIK3CA % COSMIC Wellcome Trust SANGER Institute KRAS mutations in adenocarcinomas of large intestine

55 K-RAS Mutations Electropherograms …… GGA GCT GGT GGC GTA GGC …… G12D G12S WT SnaPShot Sequencing G12D Wild-type

56 KRAS Testing Characteristics of Selected Assays Methodology Kit (Manufacturer) Mutations detectedFeatures Direct sequencing Individual reference laboratory All Direct sequence information Independent of allele present Allele-specific real-time PCR TaqMan TM KRAS- specific primer + probe sets (Applied Biosystems) Any designed Result depends on individual assay design Single-tube amplification + detection Real-time PCR detection using allele-specific primer-probes TheraScreen TM K-RAS Kit (DxS) G12D G12A G12V G12S G12R G12C G13D High sensitivity and specificity Single-tube amplification + detection First CE-labelled kit Allele-specific ELISA microplate DNA hybridisation Invigene ® K-ras Genotyping Kits (Invitek) G12S G12R G12C G12D G12A G12V G13S G13R G13C G13D G13A G13V Includes sample preparation module Detection includes manual steps

57 Histopathological evaluation is essential 1.Paraffin-embedded, formalin-fixed tissue (biopsies, surgical samples) 2.Macro/microdissection can enhance sensitivity Various test methods available, all adequate 1.Direct sequencing - Sensitivity of standard sequencing techniques is sufficient in most cases - Sequencing provides direct information about the type of mutation - Detects all mutations in region sequenced 2.Allele-specific amplification and detection - Provides high sensitivity - Appropriate for high-throughput or multiplex applications - Only pre-defined mutations can be detected Detection can be performed both on primary tumor and metastasis KRAS Mutation Testing

58 DISSEZIONE MICROSCOPICA

59 CETUXIMAB SI USA IN CASI IV° STADIO RAS W. T. ora Circa il 40 % di tutti i casi di K del grosso intestino sono o diventano IV° stadio Ma circa il 50 % sono stadio II° e su questi ?

60

61 18q allelic loss in CRC The short arm of the chromosome 17 (17p) and the long arm of the chromosome 18 (18q) are frequently loss in CRC Inactivation of the p53 gene (on 17p) and DCC gene (on 18q) probably contributes to neoplastic transformation Distant metastasis of CRC is associated with deletions of 17p and 18q, and loss of 17p and 18q has prognostic value

62 18q deletion and outcome in untreated CRC 18q+ 18q- The status of chromosome 18q has strong prognostic value in patients with stage II colorectal cancer. The prognosis in patients with stage II cancer and chromosome 18q allelic loss is similar to that in patients with stage III cancer, who are thought to benefit from adjuvant therapy. In contrast, patients with stage II disease who do not have chromosome 18q allelic loss in their tumor have a survival rate similar to that of patients with stage I disease and may not require additional therapy. Jen et al. NEJM 1994

63

64 EGFR-targeted therapies

65 Molecular conditions for anti-EGFR efficiency at the receptor level at the intracellular level I. Activation of EGFR in the tumor: EGFR gain of copies, ligands overexpression II. No downstream oncogenic activation: KRAS (40%) BRAF (10%) PTEN (loss, 30%) PIK3CA? (20%)

66 A sequential strategy: KRAS Cancer Res 2007 J Clin Oncol 2008 Cancer Res 2009 BRAF PTEN PIK3CA downstream signaling

67 ?

68 The role of PIK3CA/PTEN (I) Available data of the predictive role in CRC: Preclinical: Jawher, Cancer Res 2008 Clinical: -Frattini et al. Br J Cancer Perrone et al. Ann Oncol 2009

69 Perrone F et al. Ann Oncol pts: -24% KRAS mut (p=0.03) -10% BRAF (p=ns) -13% PIK3CA mut (p=ns) -10% PTEN mut -13% PTEN loss (p=0.02)

70

71 110 metastatic colorectal cancers patients treated with the EGFR-targeted monoclonal antibodies panitumumab or cetuximab KRAS mutational status (evaluable n=109) PIK3CA/PTEN evaluation in wild-type KRAS tumors (evaluable n=59) **p<0.01 (p= ) Altered PIK3CA/PTEN 27/59 (46%) Normal PIK3CA/PTEN 32/59 (54%) Responders1**17** Non Responders26**15** *p<0.05 (p=0.019) Mutated KRAS 32/109 (29%) Wild-Type KRAS 77/109 (71%) Responders2*20* Non Responders30*57*

72 15 (13.6%) PIK3CA mutations, both in exon 9 (4 cases) and in exon 20 (11 cases); 32 (29.0%) KRAS mutations, occurring at codon 12 in 23 cases (71.9%), and at codon 13 in 8 cases (25.0%); a double point mutation involving both codons was detected in 1 case (3.1%) Concomitant PIK3CA and KRAS mutations were observed in 2 samples PTEN protein assessment was performed by immunohistochemistry analysis. Among the 81 evaluated tumor specimens, 32 (39.5%) showed loss of PTEN protein Frequency of mutations in PIK3CA and KRAS, and loss of PTEN protein expression

73

74 168 pts

75 BRAF mutation predict for poor prognosis regardless the line of treatment

76 Molecular determinants of response in CRC: what is reasonable to look for in the clinical practice? Stage II (prognostic) Stage IV (predictive) 18q LOH KRASBRAFPIK3CAPTEN experimental clinical practice

77 GRAZIE Silvio Veronese : SS Patologia Molecolare H Niguarda Milano Andrea Sartore Bianchi : Oncologia Falk Salvatore SienaH Niguarda Milano Alberto Bardelli : IRCC Candiolo


Download ppt "Dal GIST al K-RAS OVVERO Dall E.E. al D.N.A. Come è cambiata e sta cambiando lAnatomia Patologica Gallarate Aprile 2009."

Similar presentations


Ads by Google