1. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 1/33 B Cells and B Cell Development © Dr. Colin R.A. Hewitt crah1@le.ac.uk

2. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 2/33 This is second in the series of cellular immunology lectures. The purpose of the lecture is to illustrate the key points of B cell biology and to emphasise the mechanisms that B cells use to generate a diverse B cell repertoire whilst preventing self reactivity. To use the lecture, click on the projection screen icon below then just click your way through the presentation Don’t forget to try the online multiple choice questions at the end to find your strengths and weaknesses.

3. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 3/33 What you should know by the end of this lecture B cells develop pre-natally in the liver, and post-natally in the bone marrow Anti-self B cells are eliminated once Ig is expressed at the cell surface Self-reactivity is controlled by clonal deletion and clonal anergy Stages of B cell differentiation are defined by Ig gene rearrangement The structure and function of the pre-B cell receptor The meaning of, purpose of and evidence for allelic exclusion How the order of Ig gene rearrangement makes B cell development efficient The development and functions of the germinal centre

4. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 4/33 The discovery of B cell immunity 1954 - Bruce Glick, Ohio State University Studies on the function of the a lymphoid organ in the cloacal region of the chicken the bursa of Fabricius Bursectomy – no apparent effect Bursectomised chickens were later used in experiments to raise antibodies to Salmonella antigens None of the bursectomised chickens made anti-Salmonella antibodies Bursa was later found to be the organ in which antibody producing cells developed – antibody producing cells were thereafter called B cells Mammals do not have a bursa of Fabricius

5. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 5/33 Transfer foetal liver cells Origin of B cells and organ of B cell maturation No Mature B cells After birth, development continues in the bone marrow Normal bone marrow Defective bone marrow Mature B cells in periphery B cell development starts in the foetal liver

6. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 6/33 B cell development in the bone marrow B Regulates construction of an antigen receptor Bone Marrow provides a MATURATION & DIFFERENTIATION MICROENVIRONMENT for B cell development Ensures each cell has only one specificity B Checks and disposes of self-reactive B cells B Exports useful cells to the periphery B Provides a site for antibody production B

7. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 7/33 Secreted Factors - CYTOKINES 2. Secretion of cytokines by stromal cells B Bone marrow stromal cells nurture developing B cells Types of cytokines and cell-cell contacts needed at each stage of differentiation are different Stromal cell 1. Specific cell-cell contacts between stromal cells and developing B cells Cell-cell contact

8. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 8/33 Peripheral Stages of B cell development Stem CellEarly pro-B cellLate pro-B cellLarge pre-B cell Small pre-B cellImmature B cellMature B cell Each stage of development is defined by rearrangements of IgH chain genes, IgL chain genes, expression of surface Ig, expression of adhesion molecules and cytokine receptors

9. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 9/33 Early pro-B Kit Receptor Tyrosine kinase Stem cell factor Cell-bound growth factor VLA-4 (Integrin) Stem Cytokines and cell-cell contacts at each stage of differentiation are different Stromal cell Cell adhesion molecules VCAM-1 (Ig superfamily)

10. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 10/33 Early pro-B Interleukin-7 receptor Stromal cell Late pro-B Pre-B Interleukin-7 Growth factor Cytokines and cell-cell contacts at each stage of differentiation are different

11. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 11/33 Stages of differentiation in the bone marrow are defined by Ig gene rearrangement B CELL STAGE IgH GENE CONFIGURATION Stem cellEarly pro-BLate pro-BLarge pre-B Germline D H to J H V H to D H J H VHDHJHVHDHJH Pre-B cell receptor expressed Ig Light chain gene has not yet rearranged

12. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 12/33 B cell receptor Transiently expressed when V H D H J H C H  is productively rearranged VpreB/ 5 - the surrogate light chain, is required for surface expression Ig  & Ig  signal transduction molecules CHCH Heavy chain V H D H J H Light chain V L J L C L VpreB 5 Ligand for the pre-B cell receptor is unknown Pre-

13. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 13/33 Ligation of the pre-B cell receptor 1.Ensures only one specificty of Ab expressed per cell Large Pre-B Stromal cell Unknown ligand of pre-B cell receptor 2. Triggers entry into cell cycle ALLELIC EXCLUSION 1. Suppresses further H chain rearrangement 2.Expands only the pre-B cells with in frame V H D H J H joins

14. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 14/33 Evidence for allelic exclusion Allotypes can be identified by staining B cell surface Ig with antibodies a/a b/b a/b Y B b Y B a Y B b Y Y B ab Y B a AND ALLOTYPE- a polymorphism in the C region of Ig Suppression of H chain rearrangement by pre-B cell receptor prevents expression of two specificities of antibody per cell

15. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 15/33 Y Y YY Suppression of H chain gene rearrangement ensures only one specificty of Ab expressed per cell. Allelic exclusion prevents unwanted responses B Self antigen expressed by e.g. brain cells S. aureus Y Y Y Y Y B Y Y Y Y Y Y Y Anti S. aureus Antibodies Y Y Y Y Y Y Anti brain Abs One Ag receptor per cellIF there were two Ag receptors per cell Y Y Y Y Y Y Y Anti S. aureus Antibodies Prevents induction of unwanted responses by pathogens

16. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 16/33 Allelic exclusion is needed for efficient clonal selection All daughter cells must express the same Ig specificity otherwise the efficiency of the response would be compromised Suppression of H chain gene rearrangement helps prevent the emergence of new daughter specificities during proliferation after clonal selection S. typhi Antibody S. typhi

17. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 17/33 Allelic exclusion is needed to prevent holes in the repertoire Exclusion of anti-brain B cells i.e. self tolerance Y Y B B One Ag receptor per cell S. aureus Anti-brain Ig AND anti-S. Aureus Ig Y Y Y B B IF there were two Ag receptor per cell Anti-brain Ig B B Deletion Anergy OR anti S.Aureus B cells will be excluded leaving a “hole in the repertoire” BUT Y Y Y B B

18. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 18/33 1. Suppresses further H chain rearrangement Ligation of the pre-B cell receptor 1.Ensures only one specificty of Ab expressed per cell Large Pre-B Stromal cell Unknown ligand of pre-B cell receptor 2. Triggers entry into cell cycle 2.Expands only the pre-B cells with in frame V H D H J H joins

19. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 19/33 Translation in frame 1 MKXLWFFLLLVAAPRWVLSQV HLQESGPGLGKPPELKTPLGD TTHTCPRCPEPKSCDTPPPCP RCPEPKSCDTPPPCPRCPEPK SCDTPPPCXXCPAPELLGGPS VFLFPPKPKDTLMISRTPEVTC VVVDVSHEDXXVQFKWYVDG VEVHNAKTKLREEQYNSTFRV VSVLTVLHQDWLNGKEYKCKV SNKALPAPIEKTISKAKGQPEE MTKNQVSLTCLVKGFYPSDIAV EWESNGQPENNYNTTPPMLD SDGSFFLYSKLTVDKSRWQQG NIFSCSVMHEALHNRYTQKSLS LSPGK* Human IgG3 Heavy Chain nucleotide sequence ATGAAACANCTGTGGTTCTTCCTTCTCCTGG TGGCAGCTCCCAGATGGGTCCTGTCCCAGG TGCACCTGCAGGAGTCGGGCCCAGGACTGG GGAAGCCTCCAGAGCTCAAAACCCCACTTGG TGACACAACTCACACATGCCCACGGTGCCCA GAGCCCAAATCTTGTGACACACCTCCCCCGT GCCCACGGTGCCCAGAGCCCAAATCTTGTG ACACACCTCCCCCATGCCCACGGTGCCCAG AGCCCAAATCTTGTGACACACCTCCCCCGTG CCCNNNGTGCCCAGCACCTGAACTCTTGGG AGGACCGTCAGTCTTCCTCTTCCCCCCAAAA CCCAAGGATACCCTTATGATTTCCCGGACCC CTGAGGTCACGTGCGTGGTGGTGGACGTGA GCCACGAAGACCCNNNNGTCCAGTTCAAGT GGTACGTGGACGGCGTGGAGGTGCATAATG CCAAGACAAAGCTGCGGGAGGAGCAGTACA ACAGCACGTTCCGTGTGGTCAGCGTCCTCAC CGTCCTGCACCAGGACTGGCTGAACGGCAA GGAGTACAAGTGCAAGGTCTCCAACAAAGCC CTCCCAGCCCCCATCGAGAAAACCATCTCCA AAGCCAAAGGACAGCCCGAGGAGATGACCA AGAACCAAGTCAGCCTGACCTGCCTGGTCAA AGGCTTCTACCCCAGCGACATCGCCGTGGA GTGGGAGAGCAATGGGCAGCCGGAGAACAA CTACAACACCACGCCTCCCATGCTGGACTCC GACGGCTCCTTCTTCCTCTACAGCAAGCTCA CCGTGGACAAGAGCAGGTGGCAGCAGGGGA ACATCTTCTCATGCTCCGTGATGCATGAGGC TCTGCACAACCGCTACACGCAGAAGAGCCTC TCCCTGTCTCCGGGTAAATGA Large pre-B cells need in frame V H D H J H joins to mature Translation in frame 2 (no protein) * Translation in frame 3 ETXVVLPSPGGSSQMGPVPGA PAGVGPRTGEASRAQNPTW* Large pre-B Development continues Pre-B cell receptor can ligate to stromal cell Development arrests Development arrests

20. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 20/33 Proliferation Y Immature B cell Light chain expressed IgM displayed on surface IgM Ligation of the pre-B cell receptor triggers entry into the cell cycle Large pre-B Many large pre-B cells with identical pre-B receptors Large pre-B Intracellular VDJC H chain V L -J L rearranges Proliferation stops Pre-receptor not displayed Small pre-B

21. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 21/33 VDJCDJVCDJVCDJ V Germline D H -J H joining V H -D H J H joining VJCVCJ V Germline V L -J L joining Heavy and light chain rearrangement is potentially wasteful Large pre-B Small pre-B With two “random” joins to generate a heavy chain there is a 1:9 chance of a rearrangement of being in frame With one “random” join to generate a light chain there is a 1:3 chance of a rearrangement being of frame There is, therefore, only a 1:27 chance of an in frame rearrangement Out of frame rearrangements arrest further B cell maturation

22. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 22/33 B cells have several chances to successfully rearrange Ig genes Early Pro BLate Pro B Pre B V H -DJ H On first chromosome V H -DJ H On second chromosome Immature B NO YES NO B  on first chromosome  on second chromosome on first chromosome on second chromosome NO YES NO YES Y IgM  B Y IgM B D H -J H On first chromosome D H -J H On second chromosome YES NO

23. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 23/33 B Y Y Y Y B Small pre-B cell No antigen receptor at cell surface Unable to sense Ag environment !!May be self-reactive!! Immature B cell Cell surface Ig expressed Able to sense Ag environment Can now be checked for self-reactivity Acquisition of antigen specificity creates a need to check for recognition of self antigens 1.Physical removal from the repertoireDELETION 2.Paralysis of functionANERGY 3.Alteration of specificityRECEPTOR EDITING

24. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 24/33 B cell self tolerance: clonal deletion Immature B cell recognises MULTIVALENT self Ag B Clonal deletion by apoptosis Y Y B Immature B B Small pre-B Small pre-B cell assembles Ig

25. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 25/33 Y B cell self tolerance: anergy B Y Y Y B Anergic B cell IgD normal IgM low Immature B cell recognises soluble self Ag No cross-linking Y Y B Immature B B Small pre-B Small pre-B cell assembles Ig IgM IgD

26. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 26/33 Receptor editing A rearrangement encoding a self specific receptor can be replaced VCDJ VVV Y B B !!Receptor recognises self antigen!! B Apoptosis or anergy Y B B Edited receptor now recognises a different antigen and can be rechecked for specificity CDJ VVVV Arrest development And reactivate RAG-1 and RAG-2

27. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 27/33 Y Y Y Y Y Y Mature B cell exported to the periphery Y Y B cell self tolerance: export of self tolerant B cells IgD and IgM normal IgM IgD IgM Immature B cell doesn’t recognise any self Ag Y Y B Immature B B Small pre-B Small pre-B cell assembles Ig B

28. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 28/33 B cell recognises non-self antigen in periphery Ig-secreting plasma cell Differentiation in the periphery Y Y Y Y Y Y Y Y Y B YY Y Y Y Y Y B YY Y Y Y Y Y B Mature peripheral B cell

29. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 29/33 Recirculating B cells normally pass through lymphoid organs B cells in blood Efferent lymph T cell area B cell area

30. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 30/33 Antigen enters node in afferent lymphatic Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y Y B cells enter lymph node and leave blood via high endothelial venules B cells proliferate rapidly GERMINAL CENTRE Transient structure of Intense proliferation Germinal centre releases B cells that differentiate into plasma cells Recirculating B cells are trapped by foreign antigens in lymphoid organs

31. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 31/33 Dark zone Light zone B T Follicular dendritic cells select useful B cells Germinal centre anatomy 1. B cells (centroblasts) downregulate surface Ig, proliferate, somatically hypermutate their Ig genes. AFFINITY MATURATION 2. B cells (centrocytes) upregulate surface Ig, stop dividing and receive costimulatory signals from T cells and FDC 3. Apoptosis of self-reactive & unselected cells 4. Selected cells leave lymph node as memory cells or plasma cells

32. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 32/33 B cells develop in the foetal liver and adult bone marrow Stages of B cell differentiation are defined by Ig gene rearrangement Pre-B cell receptor ligation is essential for B cell development Allelic exclusion is essential to the clonal nature of immunity B cells have several opportunities to rearrange their antigen receptors Anti-self B cells are eliminated by clonal deletion and anergy Mature B cells develop in germinal centres Summary: NOW TRY THE MULTIPLE CHOICE QUESTIONS (click on this link)

33. © crah1@le.ac.uk 2000. crah1@le.ac.uk Slide 33/33 Further Reading: B cells and B cell Development N.B. You are not expected to read all of these references, but they should point you to specific areas that are covered in the lecture that you need more information on. Goodenow, CC. et al., Self tolerance checkpoints in B cell development Adv. Immunol. 1995 59:279-368 Kelsoe G. In situ studies of the germinal centre reaction Adv. Immunol. 1995 60:267-288 Winkler T. and Rolnik, AG. Roles of Ig H-chain and L-chain and of surrogate H- chain and L-chain in the development of cells of the B lymphocyte lineage. Ann. Rev. Immunol. 1994 12:209-225 Schatz, DG. et al.,V(D)J recombination - molecular biology and regulation. Ann. Rev. Immunol. 10:359-383 Hartley, SB. et al.,Elimination of self-reactive B lymphocytes proceeds in two stages – arrested development and cell death. Cell. 1993 72:325-335 Jacob J. et al., Intraclonal generation of antibody mutants in germinal centres. Nature. 1991 354:389-392 Maclennan ICM. Germinal Centres. Ann. Rev. Immunol. 1994 12:117-139 Chen C. et al., The site and stage of anti-DNA B cell deletion. Nature. 1995 373:252-255