1. Structure, Dynamics and Energetics of siRNA-Cationic Vector Complexation: A Molecular Dynamics Study Defang Ouyang a,b, Hong Zhang a, Harendra Parekh b and Sean Smith a Centre for Computational Molecular Science a, School of Pharmacy b The University of Queensland, Brisbane QLD 4072 Australia 1. Introduction Gene therapy is one promising and rapidly developing medical approach, which aims to cure genetic diseases by correcting the expression of defective genes. Although significant progress has been made in the area of gene therapy, this strategy is still hampered by the lack of effective and safe vectors for gene delivery. 2. Simulation Details 2.1 The sequence of siRNA and the structures of six cationic polymers The sequence of the 21 base pair siRNA [2]: Sense 5'- GCAACAGUUACUGCGACGUUU -3' Antisense 3'- UUCGUUGUCAAUGACGCUGCA -5‘ Six different polymers: four positive-charged G0-PAMAM dendrimer (4+dendrimer); eight positive-charged G1-PAMAM dendrimer (8+dendrimer); four positive-charged dendritic PLL (4+dendron); eight positive- charged dendritic PLL (8+dendron); four positive-charged linear PLL (4+linearlysine); and eight positive- charged linear PLL (8+linearlysine). 3. Results and Discussions  4+polymer complex with RNA on the major groove, 8+polymer complex with RNA on the major groove or on both the major groove of minor groove;  Dehydration of the complex protects the nucleic acid from the surrounding medium;  Binding energy: 8+polymer > 4+polymer;  In agreement with experimental results (low molecular weight polymer have higher transfection efficiency);  Binding free energy may be an effective index to estimate the dissociation ability of nucleic acid from the complex;  New insights into polymer-gene complexes and rational design of gene delivery systems. In our study, we explored the complexation between 21 base pair duplex siRNA and six different polymers in explicit water and counterions using fully atomistic simulation. More importantly, the binding free energies of their complexation were calculated by MM-PBSA method in AMBER. The binding energy will in the first time be introduced to explain the effect of polycations on DNA condensation and consequent gene release, which still not known in the experiments. Moreover, the binding free energy will be an important index to guide the rational design of non-viral gene delivery systems. 4. Conclusions and Future Work The mechanism of cationic carrier-anionic gene complexation is still unclear. Moreover, controlling of the strength of such binding is expected however to be an important factor in then achieving release of the gene once at the target site. Direct experimental studies of gene-carrier complexation are very sparse due to the experimental difficulties. However, molecular dynamics (MD) simulations offer the potential to shed light on this phenomenon and this is the focus of this innovative study. 2.2 The solvated RNA structure: All-atom AMBER99 force field (ff99) for RNA and the general AMBER force field for polymers. RNA duplex was generated by Nucleic Acid Builder (NAB) (http://casegroup.rutgers.edu/). All polymers were built by Material Studio 4.3 and all the primary amines were protonated. Using the LEAP module in AMBER, dendrimer was put in the major groove or minor groove of RNA. The complex was immersed in a truncated octahedral water box with a solvation shell of 8 Å thick using TIP3P model for water and Na+ is as the counterions. In recent, there was one report about fully atomistic molecular dynamics simulation of dendrimer-DNA complex [1]. Maiti et al [1] studied structure and dynamics of single- strand DNA-poly(amidoamide) (PAMAM) dendrimers complexation in explicit water and counterions by atomistic molecular dynamics simulations on molecular level. 2.3 Two steps of minimization procedure and 18 ns MD simulation; Figure 3.1 Snapshots of cationic polymer-RNA complexation at the different starting position (major or minor groove of RNA) 2.4 Calculating binding free energies for the complex by MM-PBSA method in AMBER9: In this method the average interaction energies of the receptor and the ligand are gained by calculate an ensemble of snapshots structures taken from the MD trajectory of the system. ∆G bind = ∆G solv (complex) – [∆G water (receptor) + ∆G water (ligand)] (1) ∆G water = E MM + ∆G solvation – TS (2) G solvation = G PB(GB) + G nonpolar (3) 1. Maiti, P. K.; Bagchi, B., Structure and dynamics of DNA- dendrimer complexation: Role of counterions, water, and base pair sequence. Nano Letters 2006, 6, (11), 2478-2485. 2. Putral, L. N.; Bywater, M. J.; Gu, W.; Saunders, N. A.; Gabrielli, B. G.; Leggatt, G. R.; McMillan, N. A., RNA interference against human papillomavirus oncogenes in cervical cancer cells results in increased sensitivity to cisplatin. Mol. Pharmacol. 2005, 68, (5), 1311-9. a) Four positive-charged G0-PAMAM dendrimer (4+dendrimer); b) Four positive-charged linear poly(L-lysine) (4+linearlysine). a) 4+dendrimer in the major groove in 0 ns b) 4+dendrimer in the major groove in 18 ns c) 4+dendrimer in the minor groove in 0 ns d) 4+dendrimer in the minor groove in 18 ns e) 8+dendrimer in the major groove in 18 ns f) 8+dendrimer in the minor groove in 18 ns Figure 3.2 Variation of the number of contact points between dendrimer and DNA (any contact within 3 Å) in 18 ns simulation Figure 3.3 Number of water molecules in a spine of hydration (within 3 Å of the dendrimer) between dendrimer and DNA in 18 ns simulation. Figure 3.4 Binding free energies for polymer-RNA complex in the minor or major groove 5. References