1. RNA and Protein Synthesis Ribonucleic acid: another type of nucleic acid that works with DNA to make proteins

2. mRNA From nucleus to cytoplasm DNA transcription nucleus cytoplasm translation trait protein

3. DNA vs. RNA DNA  deoxyribose sugar  nitrogen bases  G, C, A, T  T : A  C : G  double stranded  1 type RNA  ribose sugar  nitrogen bases  G, C, A, U  U : A  C : G  single stranded  3 types: M, R, & T

4. Transcription  Making mRNA from DNA  DNA strand is the template (pattern)  match bases  U : A  G : C  Enzyme  RNA polymerase

5. Matching bases of DNA & RNA  Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

6. Matching bases of DNA & RNA  Double stranded DNA unzips AGGGGGGTTACACTTTTTCCCCAA

7. Matching bases of DNA & RNA  Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A ACC RNA polymerase C C C C C G G G G A A A A A

8. Matching bases of DNA & RNA  U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA UCCCCCCAAUGUGAAAAAGGGGUU ribosome

9. protein cytoplasm nucleus trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome

10. How does mRNA code for proteins  mRNA leaves nucleus  mRNA goes to ribosomes in cytoplasm  Proteins built from instructions on mRNA aa How? mRNA UCCCCCCAAUGUGAAAAAGGGGUU

11. How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 DNA bases (A,U,G,C)? ribosome aa

12. AUGCGUGUAAAUGCAUGCGCC mRNA mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ?  Codon = block of 3 mRNA bases codon ribosome

13.  For ALL life!  strongest support for a common origin for all life  Code has duplicates  several codons for each amino acid  mutation insurance!  Start codon  AUG  methionine  Stop codons  UGA, UAA, UAG The mRNA code

14. How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA anti-codon codon tRNA UAC Met GCA Arg CAU Val  Anti-codon = block of 3 tRNA bases amino acid

15. mRNA to protein = Translation  The working instructions  mRNA  The reader  ribosome  The transporter  transfer RNA (tRNA) mRNA UCCCCCCAAUGUGAAAAAGGGGUU aa tRNA GG U aa tRNA UAC aa tRNA GA C aa AGU ribosome

16. aa mRNA From gene to protein DNA transcription nucleus cytoplasm protein translation trait UCCCCCCAAUGUGAAAAAGGGGUU ribosome tRNA aa

17. Mutations Changes to DNA are called mutations  change the DNA  changes the mRNA  may change protein  may change trait DNA TACGCACATTTACGTACG mRNA AUGCGUGUAAAUGCAUGC aa protein trait

18. Types of Mutations 1.Point mutation: change in a single base pair in DNA (substitution)‏ THE DOG BIT THE CAT THE DOG BIT THE CAR Missense mutation = changes amino acid Nonsense mutation = change to STOP Silent mutation = no change in protein

19. Types of Mutations 2. Frameshift mutation: a single base pair is added or deleted and shifts the reading of the codons THE DOG BIT THE CAT THE DOG SBI TTH ECA T

20. Mutations 3. Chromosomal mutations: any change in the structure or number of chromosomes, common in plants deletion: part of a chromosome is removed insertion and translocation: part of a chromosome breaks off and attaches to another chromosome inversion: part of a chromosome breaks off and is reinserted backwards

21. Examples of chromosomal mutations deletion duplication inversion translocation 12.4

22. Gene Regulation Only a small percent of genes are expressed (~3%)‏ Genes that are expressed have a proteins that control their expression “TATA box”: sequence at the beginning of a transcription site in eukaryotes

23. The Operon Four regions of DNA control the production of a protein a structural gene that holds the codons for the amino acid sequence found in the enzyme. an operator region right in front of the structural gene. a promotor region where the RNA polymerase will bind to the DNA. a regulator gene which has a role in controling the transcription from the structural gene. The combined region of the operator and structural gene is called an operon.

25. Animations http://highered.mcgraw- hill.com/sites/0072437316/student_view0/chapter15/animations.html# http://learn.genetics.utah.edu/units/basics/firefly/