1. CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data

2. Bin Ma Title: Associate Professor Research area: Bioinformatics Office hours: Tuesday 4-5pm, Wednesday 4- 5pm. Office: MC362

3. Bioinformatics

4. Class Time Monday, MC320, 2:30-4:30pm Wednesday, MC320/MC325, 3:30-4:30pm Jan. 7. An overview session. Jan. 14 (Monday), 16 (Wednesday) will be lectured by Mark Daley.

5. Evaluation Two assignments (10 marks each) One project (30 marks) One final exam (50 marks)

6. TA: ??.

7. Topic: Whole Genome Shotgun Sequencing Sequencing machines are used to read small fragments. Then the “reads” are assembled together. How to cut and clone. How sequencing machines work. How to assemble. DIY: assemble a small genome.

8. Topic: PCR and Primer Design How to select a region of DNA and make millions of copies rapidly. How to design the “primers”. Use it to identify the criminals by FBI and polices. DIY: design a primer

9. Topic: Gene prediction

10. Gene prediction How translation is done Gene structures How to find genes, the most interesting parts on a genome. DIY: find a gene using software.

11. Topic: NCBI Entrez Where to get biological data. Use Entrez as a comprehensive data source. DIY: download and compare sequences of the same protein in 20 different mammals.

12. GCNTACACGTCACCATCTGTGCCACCACNCATGTCTCTAGTGATCCCTCATAAGTTCCAACAAAGTTTGC || ||||| | ||| |||| || |||||||||||||||||| | |||||||| | | ||||| GCCTACACACCGCCAGTTGTG-TTCCTGCTATGTCTCTAGTGATCCCTGAAAAGTTCCAGCGTATTTTGC GAGTACTCAACACCAACATTGATGGGCAATGGAAAATAGCCTTCGCCATCACACCATTAAGGGTGA---- || ||||||||| |||||| | ||||| |||||||| ||| |||||||| | | | || GAATACTCAACAGCAACATCAACGGGCAGCAGAAAATAGGCTTTGCCATCACTGCCATTAAGGATGTGGG ------------------TGTTGAGGAAAGCAGACATTGACCTCACCGAGAGGGCAGGCGAGCTCAGGTA ||||||||||||| ||| ||||||||||| || ||||||| || |||| | TTGACAGTACACTCATAGTGTTGAGGAAAGCTGACGTTGACCTCACCAAGTGGGCAGGAGAACTCACTGA GGATGAGGTGGAGCATATGATCACCATCATACAGAACTCAC-------CAAGATTCCAGACTGGTTCTTG ||||||| |||| | | |||| ||||| || ||||| || |||||| ||||||||||||||| GGATGAGATGGAACGTGTGATGACCATTATGCAGAATCCATGCCAGTACAAGATCCCAGACTGGTTCTTG Topic: BLAST and PatternHunter sequence alignment

13. Homology Search Use NCBI BLAST as a tool to find similarities. Spaced seeds. How to implement the spaced seeds as computer programs. DIY: Experiment the sensitivity comparison between spaced seeds and BLAST seed.

14. Mass Spectrometry Genomics  Proteomics Proteins are more directly related to the functions of cells Many diseases are closely related to abnormal proteins Knowing which proteins are present in different cells under different conditions is useful Protein ID becomes an essential task in proteomics

15. Tandem mass spectrometry Tandem mass spectrometry (MS/MS, tandem MS) is the standard way for protein identification. LSIMQDK peptide tandem mass spectrometer MS/MS spectrum

16. Mass Spectrometry Principles of instruments Noises and complications in the data De novo sequencing SPIDER (de novo sequencing + homology search) DIY: –Use a mass spec to identify a protein –Use PEAKS software to determine a peptide –Use SPIDER software to identify a protein

17. High Performance Liquid Chromatography (HPLC) liquid (water etc.) to ESI MS/MS after 20 minutes or so

18. DIY: predict the retention time of a few peptides.

19. Protein Quantitation Several different methods for quantitation using mass spec. DIY: use a spectrum to determine the relative quantity of two proteins.

20. Next Generation Sequencing How to sequence an individual human’s whole genome (3G bps) in one day, using less than 1000 dollars. Huge impact on personalized medicine.