1. + => Bioinformatics: from Sequence to Knowledge Outline: Introduction to bioinformatics The TAU Bioinformatics unit Useful bioinformatics issues and databases: the use of genome browsers, identifying gene splicing, pseudogenes, mutation severity prediction, PCR utilities, other useful tools In brief: High-throughput technologies and experimental options The protein space 1 Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

2. The biotechnology revolution creates high-throughput data http://chagall.med.cornell.edu/BioinfoCourse/presentations2010/Lecture1_2010.pdf Late 60’s, early 70’s1980s21 st century 2 Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

3. The human genome project (HGP) Francis Collins (chairman of the international project from the NIH): “I think this is probably the most important scientific effort that mankind has ever mounted. That includes splitting the atom and going to the moon”. 1990-2003: Aim: to reveal the blueprint of human biology (3,000,000,000 letters). 3 Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

4. 4 The human genome project (HGP): sequencing strategies

5. Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University 5 Genomes for everyone 2014 + =>

6. http://www.advances-in-genomics.org/presentations/Flicek.pdf Huge amount of data What do we do with all this ??? 6 Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

7. Goal: Make sense of bio-medical data using computer tools, and thereby bridge the gap between molecular biology and computer science. Data produced by Bio-Med labs & stored in database Analysis & better understanding BioinformaticsAlgorithms and Tools Enables large scale analysis and interpretation of data. Provides computational methods for global understanding of biological data. Why Bioinformatics ? 7 Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University

8. 8 Bioinformatics topics are all linked together

9. – Bioinformatics helpdesk (phone or e-mail) for short and urgent questions - Extended consultation, usually sets of appointments and many discussions are required before analysis is complete - Research is done as part of collaboration with Bio-Med labs., resulting in joined papers or/and grant proposal submission Consultation at TAU Bioinformatics Unit Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University 9

10. Why use consultation when many databases and tools are free and easy-to-use ? Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University 10 Bioinformatics is a huge and dynamic field New databases and tools are published every day, not all are good or even working, updates are crucial ! Choosing parameters for bioinformatics tools can be tricky and may change results dramatically !!! IS Not always there IS a bioinformatics solution to every question, if not today, maybe tomorrow !

11. Rules of thumb ! Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University Use bioinformatics ! Google for new tools ! It is best to use bioinformatics tools at the planning stage of experiment, and not after performing it Make sure you use at least 2-3 different algorithms, with different parameters, rely mainly on results that agree using different analyses Stick to mainstream databases and tools, as databases vary in content, reliability, updates and handiness When you compare experiments, you are comparing the combination of the experiment and the analysis, which may vary Do not hesitate to contact us if you have questions, as experience may save you time and efforts 11

12. NameTel.Activity Dr. Metsada Pasmanik-Chor x 6992Genomics, DNA and proteins sequence analysis, microarray and Next Generation design and analysis Adva Yeheskel x 6840Proteomics and structural biology Dr. Orly Yaron and Dr. Shira Modai x 5251Microarray and next generation sequencing design and experiments (wet lab) Bioinformatics students, projects Collaborations in student projects on various subjects Goals: bioinformatics teaching, scientific research and grant proposal collaborations Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University TAU Bioinformatics Unit Web-page: http://www.tau.ac.il/lifesci/bioinformatics.htmlhttp://www.tau.ac.il/lifesci/bioinformatics.html 12

13. Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University 13 TAU Bioinformatics Unit Web-page: http://www.tau.ac.il/lifesci/bioinformatics.htmlhttp://www.tau.ac.il/lifesci/bioinformatics.html

14. Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University 14 Sequence analysis: a multistep process http://genome.cshlp.org/content/13/1/1.long Homolog genes: derived from a common ancestral gene Ortholog genes: rising from speciation Paralog genes: duplication of a chromosomal segment HomoloGene database: http://www.ncbi.nlm.nih.gov/homologene

15. Homologues and Sequence Conservation = Functionality http://www.pgaeducation.org/tutoria/WUSTL/BerkeleyPGACompGeno_Boffelli.2.ppt#325,4,SlideAGTTGAAACCTATAAATGCGTGATGGAGCGGTGGGAT TACATTTCGACTATAAATGCGTATCGCCTCGCAACCCAA Conservation scale sequence A A diverged CTATAAATGCGT CTATAAATGCGT conserved 80 million years potential functional region Metsada Pasmanik-Chor, Ph.D. TAU Bioinformatics Unit 15

16. Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University 16 http://www.ncbi.nlm.nih.gov/homologene/47906

17. Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University 17 Working example: the human estrogen receptor alpha RefSeq Genes: NM_001122742.1 NM_001122741.1 NM_001291230.1 NM_001122740.1 NM_000125.3 NM_001291230.1: [provided by RefSeq, Mar 2014].

18. UCSC: http://genome-euro.ucsc.edu/index.htmlhttp://genome-euro.ucsc.edu/index.html http://genome-euro.ucsc.edu/cgi-bin/hgTracks?db=hg19&position=chr6%3A152128814-152424408&hgsid=197277749_7mr2oIF1falEKD09ZDOn6oa4DEl5 Splicing events Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University 18 The UCSC genome browser Dec. 2013 (GRCh38/hg38) Assembly ?

19. ESR1 [NM_001122742] chr6:152011631-152424408, strand + Genomic length: 412778 bps, 10 exons Inetrgenic region Intronic region Transposons and repeats Coding exons http://ecrbrowser.dcode.org/UTR * D538G Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University 19 ECR Browser

20. Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University 20 - An integrated database of human genes that includes automatically-mined genomic, proteomic and transcriptomic information, as well as orthologies, disease relationships, SNPs, gene expression, gene function, and service links for ordering assays and antibodies. A collection of useful information concerning all human genes. http://www.genecards.org/cgi-bin/carddisp.pl?gene=ESR1&search=esr1

21. Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University 21 GeneAtlas: http://genatlas.medecine.univ-paris5.fr/fiche.php?symbol=ESR1http://genatlas.medecine.univ-paris5.fr/fiche.php?symbol=ESR1 UCSC Genome Browser on Human Mar. 2006 (NCBI36/hg18)

22. Dr. Metsada Pasmanik-Chor, Bioinformatics Unit, Tel Aviv University 22 https://fenix.tecnico.ulisboa.pt/downloadFile/3779571263334/intro_bioinformatica_55.pdf Today’s workshop