1. Today… Genome 351, 12 April 2013, Lecture 4 mRNA splicing Promoter recognition Transcriptional regulation Mitosis: how the genetic material is partitioned during cell division

2. In bacteria (most) mRNAs are co-linear with their corresponding genes +1 Promoter terminator bacteria: AACUGACGA AACTGACGA mRNA AACGA gene

3. Events involved in RNA processing Non- coding Coding sequence Noncoding Exon1Exon2 Intron Non- coding Continuous stretch of coding sequence AAAAA Non- coding Continuous stretch of coding sequence Transport to the cytoplasm Pre-mRNA

4. Proteins can be modular -Different regions can have distinct functions and the modules can correspond to exons Why does transcript splicing occur?

5. Interrupted structure allows genes to be modular secretion cell anchor enzyme binding module

6. secretion cell anchor enzyme binding module secretion cell anchor enzyme binding module Pre-mRNA: Processed-mRNA Interrupted structure allows genes to be modular secretion cell anchor enzyme binding module AAAA

7. secretion cell anchor enzyme binding module secretionenzyme Pre-mRNA: Processed-mRNA Alternative splicing or: One mRNAs exon is another one’s intron! AAAAsecretionenzyme binding module one alternative form

8. secretion cell anchor enzyme binding module enzyme Pre-mRNA: Processed-mRNA Alternative splicing or: One mRNAs exon is another one’s intron! AAAA enzyme binding module another alternative form

9. How do RNA polymerases know where to begin transcription and which way to go? promoter mRNA promoter gene mRNA promoter First worked out in bacteria by: -comparing sequences near the start sites of transcription of many genes -by studying where RNA polymerase likes to bind to DNA

10. Comparing sequences at the promoter region of many bacterial genes provides clues: How do RNA polymerases know where to begin transcription and which way to go? consensus sequence: TTGACAT…15-17bp…TATAAT transcription start site direction of transcription +1-10 region-35 region only coding (sense) strand is shown; all sequences 5’-3’

11. RNA polymerase binds to the consensus sequences in bacterial promoters RNA polymerase binds to the -35 and -10 regions: +1-10 region-35 region T A T AA T direction of transcription Would you expect RNA polymerase to bind the other way around and transcribe in the reverse direction? TT GACA T RNA polymerase

12. RNA polymerase binds to the consensus sequences in bacterial promoters RNA polymerase binds to the -35 and -10 regions: +1-10 region-35 region T A T AA T direction of transcription Would you expect RNA polymerase to bind the other way around and transcribe in the reverse direction? TT GACA T RNA polymerase

13. RNA polymerase binds to the consensus sequences in bacterial promoters +1-10 region-35 region T A T AA T TT GACA T RNA polymerase direction of transcription RNA polymerase T AA T A T T ACAG TT direction of transcription Would you expect RNA polymerase to bind this sequence and initiate transcription?

14. mRNA gene mRNA How do RNA polymerases know where to begin transcription and which way to go? In bacteria RNA polymerase binds specific sequences near the start site of transcription that orient the polymerase: -10 region-35 region TTGACATTATAAT -35 region -10 region TACAGTT TAATAT

15. In eukaryotes, RNA polymerase is regulated by DNA-binding proteins RNA polymerase:transcription factors (TF’s): +1 RNA polymerase does not efficiently bind to DNA and activate transcription on its own +1 But TF’s that bind to specific DNA sequences & to RNA polymerase can recruit RNA polymerase & activate transcription

16. In eukaryotes, RNA polymerase is regulated by DNA-binding proteins RNA polymerase: Some TF’s can also inhibit transcription transcription factors (TF’s): +1 But TF’s that bind to specific DNA sequences & to RNA polymerase can recruit RNA polymerase & activate transcription

17. Switches and Regulators - A Metaphor Switches control transcription (which take the form of DNA sequence) - Called regulatory elements (RE’s) or enhancers - Adjoin the promoter region, but can be quite distant Regulators, which take the form of proteins that bind the DNA, operate the switches - Called transcription factors (TF’s) When and how much RNA is made often is the product of multiple elements and regulators

18. Control of gene expression Each cell contains the same genetic blueprint Cell types differ in their protein content Some genes are used in almost all cells (housekeeping genes) Other genes are used selectively in different cell types or in response to different conditions.

19. An imaginary regulatory region Promoter RE1 RE2 RE3 RE4 RE5 RE6

20. Antennapedia gene is normally only transcribed in the thorax; legs are made. A mutant promoter causes the Antennapedia gene to be expressed in the thorax and also in the head, where legs result instead of antennae! Example: Antennapedia gene in fruit flies Expressing a regulatory gene in the wrong place can have disastrous consequences!!!

21. Lactose tolerance: A human example of a promoter mutation

22. Lactase levels in humans Lactase levels Age in years 2 10

23. World wide distribution of lactose intolerance

24. The cellular life cycle fertilized egg; a single cell! Mitosis: dividing the content of a cell

25. Chromosomes - a reminder How many do humans have? Photo: David McDonald, Laboratory of Pathology of Seattle 22 pairs of autosomes 2 sex chromosomes Each parent contributes one chromosome to each pair Chromosomes of the same pair are called homologs Others are called non- homologous

26. Homologous and non-homologous chromosomes 1p1p 1m1m 2p2p 2m2m 3p3p 3m3m 21 p 22 m 22 p 21 m X p or Y XmXm The zygote receives one paternal (p) and one maternal (m) copy of each homologous chromosome

27. The DNA of human chromosomes # genes# base pairs# genes# base pairs

28. The cellular life cycle cell growth; chromosome duplication chromosome segregation cell growth; chromosome duplication chromosomes decondensed chromosome segregation chromosomes condensed repeat Elements of mitosis:

29. Chromosome replication – a reminder Mechanism of DNA synthesis ensure that each double stranded DNA gets copied only once. The products of DNA replication have one new DNA strand and one old one (semi-conservative replication)

30. Chromosome structure – a reminder chromosome structure during cell growth & chromosome replication (decondensed) sister chromatids; double- stranded DNA copies of the SAME homolog held together at the centromere

31. Mitosis -- making sure each daughter cell gets one copy of each pair of chromosomes Copied chromosomes (sister chromatids) stay joined together at the centromere. Proteins pull the two sister chromatids to opposite poles Each daughter cell gets one copy of each homolog.

32. Mitosis -- homologous chromosomes 1m1m 1p1p 2 copies 1 m 2 copies 1 p 1m1m 1p1p 1m1m 1p1p joined at centromer e 2 copies 1 m 1m1m 1p1p 1m1m 1p1p 2 copies 1 p exact copies

33. Mitosis – following the fate of CFTR CFTR + CFTR - CFTR + CFTR - 2 copies CFTR + 2 copies CFTR - 2 copies CFTR + 2 copies CFTR - CFTR + CFTR - CFTR + CFTR - CFTR + CFTR - A CFTR heterozygote (CFTR + /CFTR - )

34. GTGCACCTGACTCCTGAGGAG CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG CTCCACAGGAGTCAGGTGCAC Mitosis -- 2 copies of each chromosome at the start Paternal chromosome Maternal chromosome A closer look at the chromosomes

35. GTGCACCTGACTCCTGAGGAG CTCCACAGGAGTCAGGTGCAC CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG DNA strands separate followed by new strand synthesis A closer look at the chromosomes

36. GTGCACCTGACTCCTGAGGAG CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG CTCCACAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG CTCCACAGGAGTCAGGTGCAC Mitosis -- after replication 4 copies Homologs unpaired sister chromatids joined by centromere GTGCACCTGACTCCTGAGGAG CTCCTCAGGAGTCAGGTGCAC A closer look at the chromosomes

37. GTGCACCTGACTCCTGAGGAG CTCCTCAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG CTCCACAGGAGTCAGGTGCAC GTGCACCTGACTCCTGTGGAG CTCCACAGGAGTCAGGTGCAC Each daughter has a copy of each homolog GTGCACCTGACTCCTGAGGAG CTCCTCAGGAGTCAGGTGCAC A closer look at the chromosomes

38. Mitosis and the cell cycle

39. Mitosis vs. Meiosis - The goal of mitosis is to make more “somatic” cells: each daughter cell should have the same chromosome set as the parental cell - The goal of meiosis is to make sperm and eggs: each daughter cell should have half the number of chromosome sets as the parental cell

40. Meiosis: the formation of gametes The challenge: ensuring that homologues are partitioned to separate gametes The solution: Hold homologous chromosomes together by crossing over target homologues to opposite poles of the cell… then separate the homologues