Presentation is loading. Please wait.

Presentation is loading. Please wait.

Annet Damhuis, Vikki Moye and Sian Ellard Department of Molecular Genetics.

Similar presentations


Presentation on theme: "Annet Damhuis, Vikki Moye and Sian Ellard Department of Molecular Genetics."— Presentation transcript:

1 Annet Damhuis, Vikki Moye and Sian Ellard Department of Molecular Genetics

2 Clinical features Diabetes Renal developmental abnormalities Female genital tract malformations

3 Genetics Heterozygous HNF1B mutations Whole gene deletions account for 50% of mutations Renal Cysts And Diabetes syndrome (RCAD)

4 KT: Double uterus Unilateral renal agenesis RT: Dysplastic kidneys Diabetes at 30 months KT RT

5 HNF1B MLPA results RT

6 3 affected family members over 3 generations quantitative multiplex PCR amplification of short fluorescent fragments Duplication of HNF1B exon 5

7 HNF1B MLPA results KT

8

9 Normal dosage 3456

10 Inverted tandem duplication (tail to tail)

11 Normal dosage Inverted tandem duplication (tail to tail) Direct tandem duplication (tail to head)

12 Inverted tandem duplication (tail to tail) max bp

13 Inverted tandem duplication (tail to tail) Direct tandem duplication (tail to head) max bp max bp

14 Inverted tandem duplication (tail to tail) Direct tandem duplication (tail to head) max bp max bp Control primerset: HNF1B fragment 1000 bp

15 LongRange PCR buffer2.5 ul dNTP mix1.25ul Primer (10pmol/ul)2.0 ul H 2 O 9.05 ul Enzyme mix0.2 ul 15ul PCR mix + 10 ul DNA (40ng/ul)

16 Primers designed with annealing temp 62°C Elongation time: 1 min/kb PCR program 3 min93°C 15 sec93°C 30 sec62°C 10 min68°C 4°C

17 1.Proband RT 1 2.Proband RT 2 3.Mother KT 4.Normal control 1 5.Normal control 2 6.Normal control 3 7.Negative control

18 1.Normal control 1 2.Normal control 2 3.Normal control 3 4.Negative control

19 1.Proband RT (1) 2.Proband RT (2) 3.Mother KT 4.Normal control 1 5.Normal control 2 6.Normal control 3 7.Negative control

20 1.Proband RT 2.Mother KT 1 3.Mother KT 2 4.Normal control 1 5.Normal control 2 6.Normal control 3 7.Negative control

21 1.Proband RT 2.Mother KT 1 3.Mother KT 2 4.Normal control 1 5.Normal control 2 6.Normal control 3 7.Negative control Fragment size approximately 3500 bp

22 1.Proband RT 1 2.Proband RT 2 3.Mother KT 1 4.Normal control 1 5.Normal control 2 6.Normal control 3 7.Negative control 8.empty

23 bp

24 GCTGTGGCGGTAGATAGCCTGCTTTCAACCCCAATTCTACCACTTGGGCACACTTCTTAACTT CTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCAACCTTATAGATTATAGG TATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATTAATGTAATTCAGGCTCT CCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGAAGAATGGCTAAATAAGG AAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGCTCTCTTCTCCTCGAGAGC CACACCAGAGCCTAAGCCCCTGACTCCCAGGGCGGCATAGCCTGCTCTGTCCCTGCGTTCAG GCCCACTTCAGCCATCTTCATCAGATCACTCCATGGATTGGCCTTTTCTCTGCATAGGCCTCT CCTCCCCAGCCTTCCATTCTGCCCACGGCCCCTTCATACTCCCAACCAAGACTGCTGTGATTG TGTGTTTTTGGCCAAGCACCAACAAGTCCCCCCGCCCCCCCTCACTCACCATCTCCCCTCCAT CCATTCCCAGGGCAGAATGTTTGCAGCGAGGGGTTCCCCCCCCAAAGCCCCACCCGCCT Results Sequencing LongRange fragment 3500bp bp 626 bp

25 GCTGTGGCGGTAGATAGCCTGCTTTCAACCCCAATTCTACCACTTGGGCACACTTCTTAACTT CTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCAACCTTATAGATTATAG GTATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATTAATGTAATTCAGGCTC TCCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGAAGAATGGCTAAATAAG GAAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGCTCTCTTCTCCTCGAGAG CCACACCAGAGCCTAAGCCCCTGACTCCCAGGGCGGCATAGCCTGCTCTGTCCCTGCGTTCA GGCCCACTTCAGCCATCTTCATCAGATCACTCCATGGATTGGCCTTTTCTCTGCATAGGCCTC TCCTCCCCAGCCTTCCATTCTGCCCACGGCCCCTTCATACTCCCAACCAAGACTGCTGTGATT GTGTGTTTTTGGCCAAGCACCAACAAGTCCCCCCGCCCCCCCTCACTCACCATCTCCCCTCCA TCCATTCCCAGGGCAGAATGTTTGCAGCGAGGGGTTCCCCCCCCAAAGCCCCACCCGCCT Results Sequencing LongRange fragment 3500bp bp 626 bp

26 GCTGTGGCGGTAGATAGCCTGCTTTCAACCCCAATTCTACCACTTGGGCACACTTCTTAACTT CTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCAACCTTATAGATTATAG GTATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATTAATGTAATTCAGGCTC TCCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGAAGAATGGCTAAATAAG GAAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGCTCTCTTCTCCTCGAGAG CCACACCAGAGCCTAAGCCCCTGACTCCCAGGGCGGCATAGCCTGCTCTGTCCCTGCGTTCA GGCCCACTTCAGCCATCTTCATCAGATCACTCCATGGATTGGCCTTTTCTCTGCATAGGCCTC TCCTCCCCAGCCTTCCATTCTGCCCACGGCCCCTTCATACTCCCAACCAAGACTGCTGTGATT GTGTGTTTTTGGCCAAGCACCAACAAGTCCCCCCGCCCCCCCTCACTCACCATCTCCCCTCCA TCCATTCCCAGGGCAGAATGTTTGCAGCGAGGGGTTCCCCCCCCAAAGCCCCACCCGCCT Intron 5 Results Sequencing LongRange fragment 3500bp bp 626 bp

27 GCTGTGGCGGTAGATAGCCTGCTTTCAACCCCAATTCTACCACTTGGGCACACTTCTTAACTT CTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCAACCTTATAGATTATAG GTATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATTAATGTAATTCAGGCTC TCCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGAAGAATGGCTAAATAAG GAAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGCTCTCTTCTCCTCGAGAG CCACACCAGAGCCTAAGCCCCTGACTCCCAGGGCGGCATAGCCTGCTCTGTCCCTGCGTTCA GGCCCACTTCAGCCATCTTCATCAGATCACTCCATGGATTGGCCTTTTCTCTGCATAGGCCTC TCCTCCCCAGCCTTCCATTCTGCCCACGGCCCCTTCATACTCCCAACCAAGACTGCTGTGATT GTGTGTTTTTGGCCAAGCACCAACAAGTCCCCCCGCCCCCCCTCACTCACCATCTCCCCTCCA TCCATTCCCAGGGCAGAATGTTTGCAGCGAGGGGTTCCCCCCCCAAAGCCCCACCCGCCT Intron 5 Results Sequencing LongRange fragment 3500bp bp 626 bp

28 GCTGTGGCGGTAGATAGCCTGCTTTCAACCCCAATTCTACCACTTGGGCACACTTCTTAACTT CTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCAACCTTATAGATTATAG GTATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATTAATGTAATTCAGGCTC TCCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGAAGAATGGCTAAATAAG GAAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGCTCTCTTCTCCTCGAGAG CCACACCAGAGCCTAAGCCCCTGACTCCCAGGGCGGCATAGCCTGCTCTGTCCCTGCGTTCA GGCCCACTTCAGCCATCTTCATCAGATCACTCCATGGATTGGCCTTTTCTCTGCATAGGCCTC TCCTCCCCAGCCTTCCATTCTGCCCACGGCCCCTTCATACTCCCAACCAAGACTGCTGTGATT GTGTGTTTTTGGCCAAGCACCAACAAGTCCCCCCGCCCCCCCTCACTCACCATCTCCCCTCCA TCCATTCCCAGGGCAGAATGTTTGCAGCGAGGGGTTCCCCCCCCAAAGCCCCACCCGCCT Intron 5Intron 3 Results Sequencing LongRange fragment 3500bp bp 626 bp

29 GCTGTGGCGGTAGATAGCCTGCTTTCAACCCCAATTCTACCACTTGGGCACACTTCTTAACTT CTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCAACCTTATAGATTATAG GTATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATTAATGTAATTCAGGCTC TCCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGAAGAATGGCTAAATAAG GAAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGCTCTCTTCTCCTCGAGAG CCACACCAGAGCCTAAGCCCCTGACTCCCAGGGCGGCATAGCCTGCTCTGTCCCTGCGTTCA GGCCCACTTCAGCCATCTTCATCAGATCACTCCATGGATTGGCCTTTTCTCTGCATAGGCCTC TCCTCCCCAGCCTTCCATTCTGCCCACGGCCCCTTCATACTCCCAACCAAGACTGCTGTGATT GTGTGTTTTTGGCCAAGCACCAACAAGTCCCCCCGCCCCCCCTCACTCACCATCTCCCCTCCA TCCATTCCCAGGGCAGAATGTTTGCAGCGAGGGGTTCCCCCCCCAAAGCCCCACCCGCCT Intron 5Intron 3 Results Sequencing LongRange fragment 3500bp bp 626 bp

30 GCTGTGGCGGTAGATAGCCTGCTTTCAACCCCAATTCTACCACTTGGGCACACTTCTTAACTT CTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCAACCTTATAGATTATAG GTATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATTAATGTAATTCAGGCTC TCCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGAAGAATGGCTAAATAAG GAAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGCTCTCTTCTCCTCGAGAG CCACACCAGAGCCTAAGCCCCTGACTCCCAGGGCGGCATAGCCTGCTCTGTCCCTGCGTTCA GGCCCACTTCAGCCATCTTCATCAGATCACTCCATGGATTGGCCTTTTCTCTGCATAGGCCTC TCCTCCCCAGCCTTCCATTCTGCCCACGGCCCCTTCATACTCCCAACCAAGACTGCTGTGATT GTGTGTTTTTGGCCAAGCACCAACAAGTCCCCCCGCCCCCCCTCACTCACCATCTCCCCTCCA TCCATTCCCAGGGCAGAATGTTTGCAGCGAGGGGTTCCCCCCCCAAAGCCCCACCCGCCT Intron 5Intron 3 Exon 4 Results Sequencing LongRange fragment 3500bp bp 626 bp

31 GCTGTGGCGGTAGATAGCCTGCTTTCAACCCCAATTCTACCACTTGGGCACACTTCTTAACTT CTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCAACCTTATAGATTATAG GTATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATTAATGTAATTCAGGCTC TCCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGAAGAATGGCTAAATAAG GAAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGCTCTCTTCTCCTCGAGAG CCACACCAGAGCCTAAGCCCCTGACTCCCAGGGCGGCATAGCCTGCTCTGTCCCTGCGTTCA GGCCCACTTCAGCCATCTTCATCAGATCACTCCATGGATTGGCCTTTTCTCTGCATAGGCCTC TCCTCCCCAGCCTTCCATTCTGCCCACGGCCCCTTCATACTCCCAACCAAGACTGCTGTGATT GTGTGTTTTTGGCCAAGCACCAACAAGTCCCCCCGCCCCCCCTCACTCACCATCTCCCCTCCA TCCATTCCCAGGGCAGAATGTTTGCAGCGAGGGGTTCCCCCCCCAAAGCCCCACCCGCCT Intron 5Intron 3 Exon 4Primer Results Sequencing LongRange fragment 3500bp bp 626 bp

32 GCTGTGGCGGTAGATAGCCTGCTTTCAACCCCAATTCTACCACTTGGGCACACTTCTTAACTT CTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCAACCTTATAGATTATAG GTATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATTAATGTAATTCAGGCTC TCCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGAAGAATGGCTAAATAAG GAAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGCTCTCTTCTCCTCGAGAG CCACACCAGAGCCTAAGCCCCTGACTCCCAGGGCGGCATAGCCTGCTCTGTCCCTGCGTTCA GGCCCACTTCAGCCATCTTCATCAGATCACTCCATGGATTGGCCTTTTCTCTGCATAGGCCTC TCCTCCCCAGCCTTCCATTCTGCCCACGGCCCCTTCATACTCCCAACCAAGACTGCTGTGATT GTGTGTTTTTGGCCAAGCACCAACAAGTCCCCCCGCCCCCCCTCACTCACCATCTCCCCTCCA TCCATTCCCAGGGCAGAATGTTTGCAGCGAGGGGTTCCCCCCCCAAAGCCCCACCCGCCT Intron 5Intron 3 Exon 4Primer Results Sequencing LongRange fragment 3500bp bp 626 bp

33 GCTGTGGCGGTAGATAGCCTGCTTTCAACCCCAATTCTACCACTTGGGCACACTTCTTAACTT CTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCAACCTTATAGATTATAG GTATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATTAATGTAATTCAGGCTC TCCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGAAGAATGGCTAAATAAG GAAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGCTCTCTTCTCCTCGAGAG CCACACCAGAGCCTAAGCCCCTGACTCCCAGGGCGGCATAGCCTGCTCTGTCCCTGCGTTCA GGCCCACTTCAGCCATCTTCATCAGATCACTCCATGGATTGGCCTTTTCTCTGCATAGGCCTC TCCTCCCCAGCCTTCCATTCTGCCCACGGCCCCTTCATACTCCCAACCAAGACTGCTGTGATT GTGTGTTTTTGGCCAAGCACCAACAAGTCCCCCCGCCCCCCCTCACTCACCATCTCCCCTCCA TCCATTCCCAGGGCAGAATGTTTGCAGCGAGGGGTTCCCCCCCCAAAGCCCCACCCGCCT bp 626 bp Fragment size approximately 293 bp

34 1.Proband RT 2.Proband RT 3.Mother KT 4.Mother KT 5.Normal control 1 6.Normal control 2 7.Normal control 3 8.Negative control Results Short fragment PCR

35 CGGGCCTTCCTTACTTTCTCTAAATTTCAGTATCCTTCTCTATGAAATAGGGATAATAATACCA ACCTTATAGATTATAGGTATATAAAGAACCTAGCATAGTGAAGAGACCATAAATGACAGCATT AATGTAATTCAGGCTCTCCAAATTATCATGTAAGGATCACCACTGATACCCTTGGCAGTGGGA AGAATGGCTAAATAAGGAAGCCCCATCTGGACCTTCCCCTGGACTGCCTGTCCCCGGCTTGC TCTCTTCTCCTCGAGAGCCACACCAGAGCCTAA Intron 5Intron 3primers Results Sequence analysis short fragment bp 626 bp 293 bp

36 KT: Double uterus Unilateral renal agenesis RT: Dysplastic kidneys Diabetes at 30 months Family MY2491RT Low level mosaic duplication RT Heterozygous duplication

37 Direct tandem duplication (tail to head) Junction fragment assay (293bp) identified duplication in mother KT LongRange PCR is a useful tool to determine junctions in duplications found by MLPA Easy to use Not always necessary to redesign primers

38 Michael Day Kevin Colclough All staff at the Molecular Genetics Laboratory in Exeter


Download ppt "Annet Damhuis, Vikki Moye and Sian Ellard Department of Molecular Genetics."

Similar presentations


Ads by Google