1. An Action Sequencing-based View of Dynamic Competitive Interaction WALTER J. FERRIER University of Kentucky November 1999

2. Firm A’s Actions Firm B’s Actions Competitive Interaction Competitive Outcomes Industry Characteristics Organizational Characteristics

3. Event Dyad 1 Event Dyad 2 Event Dyad 3 Event Dyad 4 Actor 1 Actor 2 Prior Studies: Action-Reaction Dyads time Action Char. n Irreversibility n Magnitude n Radicality Reaction Char. n Likelihood n Type n Speed

4. Actor 1 Actor 2 Prior Studies: Action Repertoires time Firm Performance n Profitability n Sales growth n Market share Year-End Measures Repertoire Char. n Total actions n Simplicity n Avg. Timing

5. a b c d e f g h 8765432187654321 Sequential Competitive Interaction ? This Sequence: Black: Knight b4 White: Pawn c3 Black: Bishop g4 White: Queen b5 Black: Pawn c5 Named Sequences: Epaulette’s Mate Sicilian Defense

6. Sequences in Strategy Research? n Ordered sample of things –Temporal orderliness among elements n Logically unified sequence –Succession of market-based decisions n Patterns in stream of behaviors n Coordinated series of actions n Actions in a sequential strategic thrust

7. Event Sequence 1 Event Sequence 2 Action Sequences time Sequence Structure n Predictability n Complexity n Timing n Duration Firm Performance n Profitability n Sales growth n Market share

8. Competing Forces for Strategic Change and Adaptation Timing Predictability Action Type(s) EnablingForces ConstrainingForces

9. Rival’s Actions Industry Growth Barriers to Entry Rival’s Actions Industry Growth Barriers to Entry Factors Influencing Sequence Structure TMT Heterogeneity Slack Awareness Motivation Ability Complexity Unpredictability Differentiation Response Timing Duration

10. Firm Performance: Sales Growth Profitability Sequence Structure and Performance Sequence Structure: Complexity Unpredictability Differentiation Fast Response Timing Long Duration

11. Sample and Data n Matched pairs: –Single-/Dominant-business firms (S.R. >.70) –U.S. market share leaders and challenger (No.2) –1987-1993 Cross-sectional time series panel n Actions: –News reports in F&S Predicasts, 1987-93 –Structured content analysis –Reliable set of key words

12. Action Sequence n Ordered sample of action events Time n Competitive actions: –Externally-directed, specific, observable moves Smith, Grimm, Gannon & Chen, 1991 Miller & Chen, 1996 Hambrick, Cho & Chen, 1996 Young, Smith & Grimm, 1996 Ferrier, Smith & Grimm, 1999

13. Definitions of Action Types

14. Sequence Structure n Elemental Complexity –Herfindahl Index of within-sequence action diversity –Low Scores: Complex sequence –High Scores: Simple sequence MKT PRICESIGMKTPRODPRICE Time

15. MKT PRICEMKTPRODPRICE Time MKT PRICESIGPRODPRICE Sequence 1 Sequence 2 MKT n Unpredictability (focal firm) n Differentiated (vis-à-vis rival firm) –Optimal Matching: Index of resemblance of two sequences, INDEL costs –High scores: Sequences are different –Low scores: Sequences are similar Inter-sequence Dissimilarity

16. Sequence Chronology MKT PRICEMKTPRICE SVCPROD Rival Firm (a) (b) Time Focal Firm n Average Sequence Duration (a) –Greater No. days: Firm sustains attack n Average Sequence Response Lag (b) –Smaller No. days: Firm fast to respond/attack

17. TMT Heterogeneity Variables n Educational Background –Blau’s index of heterogeneity for degree types (BBA, BSME, JD, etc.) n Industry Tenure –Coefficient of variation of TMT members’ years spent in the focal industry Data Source: D&B Reference Book of Corporate Management, 1987-93

18. Industry Variables n Industry Growth –Simple growth rate year t  year t+1 n Industry Concentration –Herfindahl index n Barriers to Entry –Sum of industry means for R&D, SG&A, and total assets Data Source: COMPUSTAT Industry Segment Files, 1987-93

19. Influence of Firm and Industry Characteristics on Sequence Structure

20. Rivalry and Sequence Structure Similar Differentiated Extent of Rivalrous Differentiation Unpredictable Faster Timing

21. TMT Heterogeneity and Sequence Structure Homogeneous Heterogeneous Extent of TMT Heterogeneity Unpredictable Complexity Industry Heterogeneity Educational Heterogeneity

22. Industry Context and Sequence Structure Low Growth Low Barriers Unpredictable High Growth High Barriers

23. Influence of Sequence Structure on Performance

24. Strategic Repertoire Complexity and Performance Performance SimpleComplex Extent of Elemental Complexity

25. Strategic Unpredictability and Performance Performance RoutineErratic Extent of Sequence Predictability

26. Strategic Pattern Differentiation and Performance Performance SimilarDifferent Extent of Sequence Differentiation

27. Duration of Strategic Attack and Performance Performance Short Sustained Extent of Subsequence Duration

28. Focal Firm Rival Firm Conclusions: Sequence Matters Sequence Structure n Predictability n Complexity n Timing n Duration Firm Performance n Profitability n Sales growth n Market share

29. Upper Echelons Learning & Change Competitive Dynamics Action Sequences Implications: Synthesized Perspectives

30. Sequence Applications... LANGUAGE: BOXING: DNA: qcheaTiueissesne. hsiT si a cesneueq. This is a sequence. Jab...Jab…Uppercut CAGTACATAGTACGATACGA MUSIC: COMPUTER PROGRAM: data actions2; subj = _n_; do i = 1 to max; output = matrix; end; run;