Download presentation
Presentation is loading. Please wait.
Published byAlan Arnold Modified over 8 years ago
1
DNA structure By Dr. NAGLAA FATHY Ass. Prof. of Biochemistry & Molecular Biology Ass. Prof. of Biochemistry & Molecular Biology Faculty of Medicine Benha University E-mail : naglaa_fathy722000@yahoo.com naglaa_fathy722000@yahoo.com nagla.alhusseini@fmed.bu.edu.eg
2
Introduction The Central Dogma of Molecular Biology DNA mRNA Transcription Cell Polypeptide (protein) Translation Ribosome
3
OH O CH 2 Sugar H H H A Nucleotide Adenosine Mono Phosphate (AMP) OH NH 2 N N N N Base P O OH HO O Phosphate 2’3’ 4’ 5’ 1’ Nucleotide Nucleoside H+H+ -
4
Pyrimidines NH 2 O N N NH N Guanine N N Adenine N N NH 2 N O N O N Cytosine Purines Uracil (RNA) CH 3 N O N O NH N O N O Thymine (DNA)
5
N O H N O N N H Cytosine H O N N N N N H H Guanine - + + + - - Base Pairing Guanine And Cytosine
6
CH 3 N O N O N H + - Thymine N N N N H N H - + Adenine Base Pairing Adenine And Thymine
7
Base Pairing Adenine And Cytosine N O H N O N N H Cytosine - + - N N N N H N H - + Adenine
8
Base Pairing Guanine And Thymine CH 3 N O N O N H + - Thymine H O N N N N N H H Guanine + + -
9
SUGAR-PHOSPHATE BACKBONE H P O HO O O CH 2 HOH P O O HO O O CH 2 H P O OH HO O O CH 2 NH 2 N N N N O O N NH N N N O NH 2 N B A S E S DNADNADNADNA O H P O HO O O CH 2 HO O H2NH2N N HN N N H H P HO O O CH 2 O O N O H2NH2N N H H2OH2O HOH P O HO O O CH 2 CH 3 O O HN N H2OH2O 5’Phosphate group 3’Hydroxyl group 5’Phosphate group 3’Hydroxyl group
10
The Watson - Crick Model Of DNA 3.4 nm 1 nm 0.34 nm Major groove Minor groove A T T A G C C G G C T A A T G C T A A T C G - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
11
Forms of the Double Helix 0.26 nm 2.8 nm Minor groove Major groove C G A T T A G C C G G C T A A T G C T A A T C G A T G C 1.2 nm A DNA 1 nm Major groove Minor groove A T T A G C C G G C T A A T G C T A A T C G 0.34 nm 3.9 nm B DNA +34.7 o Rotation/Bp 11 Bp/turn -30.0 o Rotation/Bp 12 Bp/turn +34.6 o Rotation/Bp 10.4 Bp/turn C G G C C G G C G CG C C G G C C G 0.57 nm 6.8 nm 0.9 nm Z DNA
12
C-DNA: –Exists only under high dehydration conditions –9.3 bp/turn, 0.19 nm diameter and tilted bases D-DNA: –Occurs in helices lacking guanine –8 bp/turn E-DNA: –Like D-DNA lack guanine –7.5 bp/turn P-DNA: –Artificially stretched DNA with phosphate groups found inside the long thin molecule and bases closer to the outside surface of the helix –2.62 bp/turn Even More Forms Of DNA B-DNA appears to be the most common form in vivo. However, under some circumstances, alternative forms of DNA may play a biologically significant role.
13
Denaturation and Renaturation Heating double stranded DNA can overcome the hydrogen bonds holding it together and cause the strands to separate resulting in denaturation of the DNA When cooled relatively weak hydrogen bonds between bases can reform and the DNA renatures TACTCGACATGCTAGCAC ATGAGCTGTACGATCGTGATGAGCTGTACGATCGTG Double stranded DNA TACTCGACATGCTAGCAC ATGAGCTGTACGATCGTGATGAGCTGTACGATCGTG Double stranded DNA Renaturation TACTCGACATGCTAGCAC ATGAGCTGTACGATCGTGATGAGCTGTACGATCGTG Denatured DNA Denaturation Single stranded DNA
14
Denaturation and Renaturation DNA with a high guanine and cytosine content has relatively more hydrogen bonds between strands This is because for every GC base pair 3 hydrogen bonds are made while for AT base pairs only 2 bonds are made Thus higher GC content is reflected in higher melting or denaturation temperature Intermediate melting temperature Low melting temperature High melting temperature 67 % GC content - TGCTCGACGTGCTCGTGCTCGACGTGCTCG ACGAGCTGCACGAGCACGAGCTGCACGAGC 33 % GC content - TACTAGACATTCTAG ATGATCTGTAAGATC TACTCGACAGGCTAG ATGAGCTGTCCGATC 50 % GC content -
15
Comparison of melting temperatures can be used to determine the GC content of an organisms genome To do this it is necessary to be able to detect whether DNA is melted or not Absorbance at 260 nm of DNA in solution provides a means of determining how much is single stranded Single stranded DNA absorbs 260 nm ultraviolet light more strongly than double stranded DNA does although both absorb at this wavelength Thus, increasing absorbance at 260 nm during heating indicates increasing concentration of single stranded DNA Determination of GC Content
Similar presentations
© 2024 SlidePlayer.com Inc.
All rights reserved.