1. DNA

2. Genetics & DNA

3. DNA: Picture 51 http://info.bio.cmu.edu/courses/03231/ProtStruc/ProtStruc.htm B-DNA: The advent of modeling http://molvis.sdsc.edu/pdb/dna_b_form.pdb 46 Å 12 base sequence (1953-2003)

4. DNA: Size, Shape & Self Assembly http://www.umass.edu/microbio/chime/beta/pe_alpha/atlas/atlas.htm Views & Algorithms 10.85 Å Several formats are commonly used but all rely on plotting atoms in 3 dimensional space;.pdb is one of the most popular.

8. Pyrimidines and Purines

9. In order to understand the structure and properties of DNA and RNA, we need to look at their structural components. We begin with certain heterocyclic aromatic compounds called pyrimidines and purines.

10. Pyrimidines and Purines Pyrimidine and purine are the names of the parent compounds of two types of nitrogen- containing heterocyclic aromatic compounds. N N N N N NH PyrimidinePurine

11. Important Pyrimidines Pyrimidines that occur in DNA are cytosine and thymine. Cytosine and uracil are the pyrimidines in RNA. HNHNHNHN NHNHNHNHOO Uracil HNHNHNHN NHNHNHNHOO CH 3 Thymine HNHNHNHN NHNHNHNH NH2NH2NH2NH2 O Cytosine

12. Important Purines Adenine and guanine are the principal purines of both DNA and RNA. Adenine N N NH2NH2NH2NH2N NHNHNHNH GuanineO HNHNHNHN NHNHNHNH N N H2NH2NH2NH2N

13. Caffeine and Theobromine Caffeine (coffee) and theobromine (coffee and tea) are naturally occurring purines. Caffeine N NON N H3CH3CH3CH3C O CH 3 TheobromineO HNHNHNHN N N N O

14. Nucleosides

15. Nucleosides The classical structural definition is that a nucleoside is a pyrimidine or purine N-glycoside of D -ribofuranose or 2-deoxy- D -ribofuranose. Informal use has extended this definition to apply to purine or pyrimidine N-glycosides of almost any carbohydrate. The purine or pyrimidine part of a nucleoside is referred to as a purine or pyrimidine base.

16. Uridine and Adenosine Uridine and adenosine are pyrimidine and purine nucleosides respectively of D -ribofuranose. Uridine (a pyrimidine nucleoside) Adenosine (a purine nucleoside) OCH HOCH 2 HNHNHNHN O OHHO O N N N N O OHHO NH2NH2NH2NH2N

17. Nucleotides

18. Nucleotides Nucleotides are phosphoric acid esters of nucleosides.

19. Adenosine 5'-Monophosphate (AMP) Adenosine 5'-monophosphate (AMP) is also called 5'- adenylic acid. N N N N O OHHO NH2NH2NH2NH2 OCH 2 P HO O HO

20. Adenosine 5'-Monophosphate (AMP) Adenosine 5'-monophosphate (AMP) is also called 5'- adenylic acid. N N N N O OHHO NH2NH2NH2NH2 OCH 2 P HO O HO 1' 2'3' 4' 5'

21. Adenosine Diphosphate (ADP) N N N N O OHHO NH2NH2NH2NH2 OCH 2 P O O HO P O HO HO

22. Adenosine Triphosphate (ATP) N N N N O OHHO NH2NH2NH2NH2 OCH 2 P O O HO P O HO O P O HO HO

23. ATP Stores Energy AMP ADP ATP Each step is endothermic. Energy for each step comes from carbohydrate metabolism (glycolysis). Reverse process is exothermic and is the source of biological energy.  G° for hydrolysis of ATP to ADP is –35 kJ/mol

24. Nucleic Acids

25. Nucleic acids are polymeric nucleotides (polynucleotides). 5' Oxygen of one nucleotide is linked to the 3' oxygen of another.

26. What are the bases? A section of a polynucleotide chain.

27. Structure and Replication of DNA: The Double Helix

28. Composition of DNA Erwin Chargaff (Columbia Univ.) studied DNAs from various sources and analyzed the distribution of purines and pyrimidines in them. The distribution of the bases adenine (A), guanine (G), thymine (T), and cytosine (C) varied among species. But the total purines (A and G) and the total pyrimidines (T and C) were always equal. Moreover: %A = %T, and %G = %C

29. Composition of Human DNA Adenine (A) 30.3%Thymine (T) 30.3% Guanine (G) 19.5%Cytosine (C) 19.9% Total purines: 49.8%Total pyrimidines: 50.1% For example: PurinePyrimidine

30. Base Pairing Watson and Crick proposed that A and T were equal because of complementary hydrogen bonding. 2-deoxyribose 2-deoxyribose AT

31. Base Pairing Likewise, the amounts of G and C were equal because of complementary hydrogen bonding. 2-deoxyribose 2-deoxyribose GC

32. The DNA Duplex Watson and Crick proposed a double-stranded structure for DNA in which a purine or pyrimidine base in one chain is hydrogen bonded to its complement in the other.

33. DNA Two antiparallel strands of DNA are paired by hydrogen bonds between purine and pyrimidine bases.

34. DNA Helical structure of DNA. The purine and pyrimidine bases are on the inside, sugars and phosphates on the outside.

35. DNA Replication C G T A As the double helix unwinds, each strand acts as a template upon which its complement is constructed.

36. DNA Replication A C G T T' A' G' C'

37. DNA-Directed Protein Biosynthesis

38. DNA and Protein Biosynthesis According to Crick, the "central dogma" of molecular biology is: "DNA makes RNA makes protein." Three kinds of RNA are involved. messenger RNA (mRNA) transfer RNA (tRNA) ribosomal RNA (rRNA) There are two main stages. transcription translation

39. Transcription Transcription is the formation of a strand of mRNA using one of the DNA strands as a template. The nucleotide sequence of the mRNA is complementary to the nucleotide sequence of the DNA template. Transcription begins at the 5' end of DNA and is catalyzed by the enzyme RNA polymerase.

40. Transcription AGGTCACTG TCCAGTGAC A T G C T T T T T T C C C C C A A A A A G G A G G G As double-stranded DNA unwinds, a complementary strand of mRNA forms at the 5' end. 5' 3'

41. Transcription AGGTCACTG TCCAGTGAC A T G C T T T T T T C C C C C A A A A A G G A G G G A A G G U C 5' 3' Uracil is incorporated in RNA instead of thymine.

42. Translation The nucleotide sequence of mRNA codes for the different amino acids found in proteins. There are three nucleotides per codon. There are 64 possible combinations of A, U, G, and C. The genetic code is redundant. Some proteins are coded for by more than one codon.

43. mRNA Codons AlanineArginineAsparagineAspartic AcidCysteine GCUGCACGUCGA AAUGAU UGU GCCGCGAGACGC AACGACUGC CGGAGG Glutamic acidGlutamineGlycineHistidineIsoleucine GAACAAGGUGGACAUAUUAUA GAGCAGGGCGGGCACAUC LeucineLysineMethioninePhenylalanineProline UUACUUAAAAUGUUUCCUCCA CUAUUGAAGUUCCCC CG CUCCUG SerineThreonineTryptophanTyrosineValine UCUUCA ACUACAUGGUAUGUUGUA AGUUCC ACCACGUACGUC GUG UCGAGC Start

45. Transfer tRNA There are 20 different tRNAs, one for each amino acid. Each tRNA is single stranded with a CCA triplet at its 3' end. A particular amino acid is attached to the tRNA by an ester linkage involving the carboxyl group of the amino acid and the 3' oxygen of the tRNA.

46. Phenylalanine tRNA

47. OCCHCH 2 C 6 H 5 NH 3 +O A C C A A A A A A A A A A A A A A A A A C C C C C C C C CC C C U U U U U U U U U U U G G G GG G G G G G G G U GG G G C This AAA triplet is complementary to a UUU triplet of mRNA; it is an anticodon.

49. Protein Synthesis

50. DNA Sequencing

51. Restriction enzymes cleave the polynucleotide to smaller fragments. These smaller fragments (100-200 base pairs) are sequenced. The two strands are separated.

52. DNA Sequencing Single stranded DNA divided in four portions. Each tube contains adenosine, thymidine, guanosine, and cytidine plus the triphosphates of their 2'-deoxy analogs. POCH 2 OHO O OOHP O OH P O HO base H HOHOHOHO O

53. DNA Sequencing The first tube also contains the 2,'3'-dideoxy analog of adenosine triphosphate (ddATP); the second tube the 2,'3'-dideoxy analog of thymidine triphosphate (ddTTP), the third contains ddGTP, and the fourth ddCTP. POCH 2 OHO O OOHP O OH P O HO base HH O

54. DNA Sequencing Each tube also contains a "primer," a short section of the complementary DNA strand, labeled with radioactive phosphorus ( 32 P). DNA synthesis takes place, producing a complementary strand of the DNA strand used as a template. DNA synthesis stops when a dideoxynucleotide is incorporated into the growing chain.

55. DNA Sequencing The contents of each tube are separated by electrophoresis and analyzed by autoradiography. There are four lanes on the electrophoresis gel. Each DNA fragment will be one nucleotide longer than the previous one.

56. Gel Electrophoresis

57. DNA Profiling DNA sequencing involves determining the nucleotide sequence in DNA. The nucleotide sequence in regions of DNA that code for proteins varies little from one individual to another, because the proteins are the same. Most of the nucleotides in DNA are in "noncoding" regions and vary significantly among individuals. Enzymatic cleavage of DNA give a mixture of polynucleotides that can be separated by electrophoresis to give a "profile" characteristic of a single individual.

58. The bloody glove? T TGTGTGTG TGATGATGATGA TGACTGACTGACTGAC TGACATGACATGACATGACA TGACATTGACATTGACATTGACAT TGACATATGACATATGACATATGACATA TGACATACTGACATACTGACATACTGACATAC TGACATACGTGACATACGTGACATACGTGACATACG TGACATACGTTGACATACGTTGACATACGTTGACATACGT ddAddTddGddC Sequence of fragment

59. The bloody glove? T TGTGTGTG TGATGATGATGA TGACTGACTGACTGAC TGACATGACATGACATGACA TGACATTGACATTGACATTGACAT TGACATATGACATATGACATATGACATA TGACATACTGACATACTGACATACTGACATAC TGACATACGTGACATACGTGACATACGTGACATACG TGACATACGTTGACATACGTTGACATACGTTGACATACGT ddAddTddGddC A ACACACAC ACTACTACTACT ACTGACTGACTGACTG ACTGTACTGTACTGTACTGT ACTGTAACTGTAACTGTAACTGTA ACTGTATACTGTATACTGTATACTGTAT ACTGTATGACTGTATGACTGTATGACTGTATG ACTGTATGCACTGTATGCACTGTATGCACTGTATGC ACTGTATGCAACTGTATGCAACTGTATGCAACTGTATGCA Sequence of fragment Sequence of original DNA

60. Genetic Fingerprinting OJ and the bloody glove! Forensics Paternity ID-military Food Wine Anthropology

61. OTHER APPLICATIONS: Transgenic Crops

62. CLONING Hello Dolly, and Lassie, and Tabby

63. PCR: Polymerase Chain Reaction

64. PCR When a sample of DNA is too small to be sequenced or profiled, the polymerase chain reaction (PCR) is used to make copies ("amplify") portions of it. PCR amplifies DNA by repetitive cycles of the following steps. 1. Denaturation 2. Annealing ("priming") 3. Synthesis ("extension" or "elongation")

65. PCR Target region (a) Consider double-stranded DNA containing a polynucleotide sequence (the target region) that you wish to amplify. (b) Heating the DNA to about 95°C causes the strands to separate. This is the denaturation step.

66. (c) Cooling the sample to ~60°C causes one primer oligonucleotide to bind to one strand and the other primer to the other strand. This is the annealing step. PCR

67. (d) In the presence of four DNA nucleotides and the enzyme DNA polymerase, the primer is extended in its 3' direction. This is the synthesis step and is carried out at 72°C. PCR

68. This completes one cycle of PCR. (d) In the presence of four DNA nucleotides and the enzyme DNA polymerase, the primer is extended in its 3' direction. This is the synthesis step and is carried out at 72°C. PCR

69. This completes one cycle of PCR. (e) The next cycle begins with the denaturation of the two DNA molecules shown. Both are then primed as before. PCR

70. (f) Elongation of the primed fragments completes the second PCR cycle. PCR

71. (g) Among the 8 DNAs formed in the second cycle are two having the structure shown. PCR

72. The two contain only the target region and and are the ones that increase disproportionately in subsequent cycles. (g) Among the 8 DNAs formed in the second cycle are two having the structure shown. PCR

73. PCR CycleTotal DNAsContain only target 0 (start)10 120 240 382 4168 53222 101,0241,004 201,048,5661,048,526 301,073,741,8241,073,741,764