Presentation is loading. Please wait.

Presentation is loading. Please wait.

English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis Tuesday, 8:30 – 10:00 ÜThursday 10:15-11:45 (start: Oct. 23) Next.

Similar presentations


Presentation on theme: "English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis Tuesday, 8:30 – 10:00 ÜThursday 10:15-11:45 (start: Oct. 23) Next."— Presentation transcript:

1 English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis Tuesday, 8:30 – 10:00 ÜThursday 10:15-11:45 (start: Oct. 23) Next semester: Praktikum + Seminar Thereafter possibility for Masters thesis. Anwesenheitspflicht in VL und Ü (Liste!) Literature: See course web page.

2 121. Okt Microarray-Technologien Martin Vingron 228. OktGrundlagen der DatenanalyseChristine Steinhoff 34. NovVarianzanalyse IChristine Steinhoff 411. NovVarianzanalyse IIChristine Steinhoff 518. NovLOWESS, VarianzstabilisierungAnja von Heydebreck 625. NovStatistisches TestenAnja von Heydebreck 72. DezClusterverfahren Anja von Heydebreck 89. DezKlassifikation, Lin. DiskriminanzanalyseRainer Spang 916. DezAnwendungen in der KrebsforschungRainer Spang 106. JanHauptkomponentenanalyse Martin Vingron JanStatistische Lerntheorie Rainer Spang JanSequenzannotationRainer Spang JanBayessche NetzwerkeRainer Spang FebRegulation Martin Vingron FebZusammenfassung, Wiederholung, Ausblick

3 Functional Genomics: Genome Sequencing: Determination of DNA sequence Derivation of amino acid sequences Analysis, comparison, classification Study of gene function gene expression studies proteomics metabolic networks

4 DNA gene transcription messenger RNA (mRNA) protein sequence structure translation

5 A cell and its population of genes :

6 What is the problem? Determine the amount of mRNA for each gene that is present in a cell/tissue.

7 DNA forms double strands by a process called hybridization:

8 Labeling

9 Hybridization

10 Expression Arrays cDNA ArraysOligonucleotide Arrays Glas ArraysMembrane based Arrays

11 Glass Slide Microarrays … were first produced at Stanford University (Schena et al, 1995). Whole cDNA: bp

12 Filter Macroarrays … were first published by Lennon and Lehrach, 1991 Ca 21 cm 7.5x2.5cm

13 Oligonucleotide Arrays … were first published by Lockhardt et al, PM MM probe pair probe set probe cell... TGTGATGGTGGGAATGGGTCAGAAGGACTCCTATGTGGGTGACGAGGCC TTACCCAGTCTTCCTGAGGATACAC TTACCCAGTCTTGCTGAGGATACAC ca 25bp

14 G C A C G C A C G C A C G C A C G C A C G C A C Probe - Reference G C A C G C A C

15 There are other technologies, too, to estimate expression levels: EST sequencing – electronic northern SAGE: tags of mRNAs are concatenated and sequenced Reliability of results depends on depth of probing (number of ESTs, number of tags)

16 Why do we want to know? tissue profiling: which genes are expressed in a tissue Comparing healthy and diseased (e.g., tumor) tissue Studying dynamic processes: E.g., cell cycle (time series)

17 Example: Renal clear cell carcinoma Comparison of kidney cancer cells to normal tissue. Which genes are altered in their expression?

18 T N Molecular Genome Analysis Dr. Judith Boer

19

20 G1 S G2 M Spellman et al took several samples per time-point and hybridized the RNA to a glass chips with all yeast genes Example: Cell cycle time course

21

22 Data processing Image collection Image analysis, intensity determination Within slide normalization

23

24 Trends in Biotech Hess et al, 19(11),2001

25 OUPUT: Scanner + Scanner-Software... Trends in Biotech Hess et al, 19(11),2001

26 Different technologies Support: membrane or glass slide Spotted material: PCR product or oligo (short/long) Labeling: –1-channel: radioactive, Affy –Absolute values –2-channel: 2 color fluorescent labeling –Relative values

27 Quality issues

28

29 subpopulations: PCR Remedies: improve PCR protocols; model random effect through plate-wise calibration Remedies: improve PCR protocols; model random effect through plate-wise calibration

30 subpopulations: pin Remedies: handling of pins; pin-wise calibration

31

32 Distribution of intensities: log-normal? intensitieslog intensities QQPlot Histogramm

33

34 Chip design Type of chip: –Global whole genome (yeast, drosophila, mouse, man) –Domain specific, e.g. cancer, infection Spots: –PCR products: E.g., 3´ UTR (avoid crosshyb.) –Oligos: uniqueness, stability

35 Databases Stanford TIGR Gene expression atlas GEO Arrayexpress MIAME standard: Minimum Information About a Microarray Experiment

36 Software R + Bioconductor Jexpress Genesprings Rosetta Resolver

37 Affymetrix technology Per gene, spot 20 perfectly matching oligos and 20 oligos with 1 mismatch Intensity: weighted average of pixel intensities in perfect and mismatch oligos (More on this next week)


Download ppt "English okay? Masters studies offer tracks: This is part of: VL Microarray data analyis Tuesday, 8:30 – 10:00 ÜThursday 10:15-11:45 (start: Oct. 23) Next."

Similar presentations


Ads by Google