1. Supplementary Material (Carriero & Damha)

2. 1 10 20 30 40 50 60 5’-GGGCGAATTCGAGCTCACTCTCTTCCGCATCGCTGTCTGCGAGGTACCCTACCAGGTGAG 3’-CCCGCTTAATCTCGAGTGAGAGAAGGCGTAGCGACAGACGCTCCATGGGATGGTCCACTC 61 70 80 90 100 110 120 TATGGATCCCTCTAAAAGCGGGCATGACTTCTAGAGTAGTCCAGGGTTTCCGAGGGTTTC ATACCTAGGGAGATTTTCGCCCGTACTGAAGATCTCATCAGGTCCCAAAGGCTCCCAAAG 121 130 140 150 160 170 180 CGTCGACGATGTCAGCTCGTCTCGAGGGTGCTGACTGGCTTCTTCTCTCTTTTTCCCTCA GCAGCTGCTACAGTCGAGCAGAGCTCCCACGACTGACCGAAGAAGAGAGAAAAAGGGAGT 181 190 200 210 220 230 GGTCCTACACAACATACTGCAGGACAAACTCTTCGCGGTCTCTGCATGCAAGCTT-3’ CCAGGATGTGTTGTATGACGTCCTGTTTGAGAAGCGCCAGAGACGTACGTTCGAA-5’ 5’-SS 3’-SS branchpoint polypyrimidine tract CQ27 PBS S1: Sequence of the PIP85.B splicing substrate gene. The 235-nt sequence is inserted between the T7 promoter region and Hind III restriction site of pBS- (Stratagene). When PCR amplified, the T7 promoter region (upstream of +1) and the 234-nt splicing sequence are produced. The 5’- and 3’-splice sites (5’-SS and 3’-SS), branch point adenosine and polypyrimidine tract are shown above. The primer binding sites (PBS) used for PCR amplification are the CQ27 primer (shown) and the universal M13F primer (not shown; located at position -47). CQ27: 5’-AGC TTG CAT GCA GAG ACC-3’; M13F: 5’-CGC CAG GGT TTT CCC AGT CAC GAC-3’

3. S2: PCR amplification of the PIP85.B splicing substrate gene. Panel A: Simplified schematic representation of PCR amplification of a double-stranded DNA substrate using two diverse primers (e.g. M13F & CQ27) and the thermophilic Taq DNA polymerase. Amplification over a number of number of cycles (N=30-35 cycles) produces an exponential amount of amplified DNA material (2 N ). Panel B: Analysis of the PIP85.B PCR product on a 2% agarose gel containing 20 ng/mL of ethidium bromide. The expected length of the PCR product is 281-nt. 506 396 344 298 1 Kb ladder PIP85.B PCR 1 2 M13F CQ27 1. Heat denature (95°C) 2. Anneal primers (45°C) 3. Taq DNA Polymerase Repeat steps 1-3 N cycles (N=30-35) 2 N copies of DNA A.B.

4. 0 10 20 30 60 90 min 1 2 3 4 5 6 E2E1 E2 E1 179-nt 125-nt 234-nt 109-nt S3: In vitro pre-mRNA splicing reaction of the PIP85.B substrate gene at various time intervals. Reaction mixtures were partitioned on a 15% (19:1 crosslink) denaturing gel (8 M urea) at constant power (75 Watts). As the reaction time progresses, the amount of mature RNA (mRNA) and lariat intron accumulate, whereas the amount of pre-mRNA and lariat-3’-exon decrease. E1: exon 1; E2: exon 2.

5. E2 E1 (-)ve (+)ve 5 10 20 0.1 0.5 2 5 10 20  M 14 15ara-AY-RNA (no L-dC)ara-AY-RNA (with L-dC) 1 2 3 4 5 6 7 8 9 10 11 S4: Inhibition of pre-mRNA splicing in HeLa nuclear extract with variable concentrations of cold Y-RNAs containing an arabino-adenosine branchpoint (14 and 15). Splicing reactions were stopped after 30 minutes. Intermediates and products were partitioned on a 15% (19:1 crosslink) denaturing gel (8 M urea) and visualized by autoradiography. The negative control [(-)ve] represents the pre-mRNA alone. The positive control [(+)ve] is the spliced RNA in the absence of any inhibitor.

6. S5: Inhibition of pre-mRNA splicing in HeLa nuclear extract with small branched oligonucleotides. Cold linear, V-shaped and Y-shaped RNAs were incubated with the pre-mRNA transcript under splicing conditions. Splicing reactions were stopped after 30 minutes. Intermediates and products were partitioned on a 15% (19:1 crosslink) denaturing gel (8 M urea) and visualized by autoradiography. Oligomer 22 is a dodecamer Y-RNA, i.e., cUAA 2’,5’ (GUc) 3’,5’ GUc. The negative control [(-)ve] represents the pre-mRNA alone. The positive control [(+)ve] is the spliced RNA in the absence of any inhibitor. Bracketed residues indicates nucleotides linked by a 2’,5’-phosphodiester bond. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 E2 E1 (-)ve(+)ve 5 10 20 5 10 20 5 10 20 5 10 20 5 10 20 5 10 20 5 10 20  M AUCA(U)UA(U)GA(G)UUA(U)UAA(G)G 22