Presentation is loading. Please wait.

Presentation is loading. Please wait.

Stuart R.W. Bellamy 1, Yana S. Kovacheva 1, Ishan Haji Zulkipi 1, Guus Harms 2, Niels Laurens 2, Gijs J.L. Wuite 2, Stephen E. Halford 1. The Dynamics.

Similar presentations

Presentation on theme: "Stuart R.W. Bellamy 1, Yana S. Kovacheva 1, Ishan Haji Zulkipi 1, Guus Harms 2, Niels Laurens 2, Gijs J.L. Wuite 2, Stephen E. Halford 1. The Dynamics."— Presentation transcript:

1 Stuart R.W. Bellamy 1, Yana S. Kovacheva 1, Ishan Haji Zulkipi 1, Guus Harms 2, Niels Laurens 2, Gijs J.L. Wuite 2, Stephen E. Halford 1. The Dynamics of DNA Binding, Looping and Dissociation by the Type II Restriction Endonuclease SfiI (1) Department of Biochemistry, University of Bristol, UK. (2) Department of Physics and Astronomy, Vrije Universiteit, Amsterdam, The Netherlands.

2 Abstract WT SfiI forms extremely stable loops in the presence of Ca 2+. In order to observe dynamic looping in the presence of divalent metal ion, two catalytically inactive mutants were generated, D79A and D100A. However, these mutants form stable loops in the presence of Ca 2+. D100A also forms stable loops in the presence of Mg 2+, but D79A forms transient loops under these conditions. TPM experiments have measured the loop lifetime and loop formation time(s) for the D79A-DNA complex in Mg 2+. Although further data analysis is required, from these experiments we can start to build up an accurate picture of the kinetics of DNA looping by SfiI in the presence of Mg 2+. [1] Szczelkun & Halford (1996) EMBO J, 15, [2] Milsom et al. (2001) JMB, 311, [3] Vanamee et al. (2005) EMBO J, 24, [4] Newman et al. (1998) EMBO J, 17, [5] van de Broek et al. (2006) NAR, 34, [6] Nobbs et. al. (1998) JMB, 281, We thank Richard Sessions, Marks Szczelkun and Dillingham and Lucy Catto for ideas and discussion. References Acknowledgements

3 SfiI is a Type II restriction endonuclease that acts at the sequence: GGCCnnnnnGGCC CCGGnnnnnCCGG + Mg 50 o C Two-site DNA: SfiI acts in cis, looping out the intervening DNA: SfiI differs from the orthodox Type II enzymes in that it is tetramer in solution and needs to bind two copies of its recognition site before displaying full activity. Consequently, while it can cleave DNA with one SfiI site by acting in trans, it works best on DNA molecules with two sites, by acting in cis. Once bound to two sites, it cuts both before dissociating from the DNA. One-site DNA: SfiI acts in trans, bridging two DNA molecules: Introduction SfiI is a prototype system for studying DNA looping. However, dynamic looping has only been detected in EDTA (t 1/2 = 4 mins [1]). In the presence of Ca 2+, SfiI forms very stable loops (t 1/2 = >7 hours [2]). The association/dissociation kinetics of SfiI were examined here by three methods: 1) Gel shift; 2) FRET; 3) Tethered particle motion (TPM)

4 In Ca 2+, DNA in the SfiI-DNA complex is not displaced by competitor DNA, even after 24 hours The dissociation of DNA from wild-type (WT) SfiI was followed in the presence of Ca 2+ to prevent cleavage. WT SfiI (5 nM) was incubated with HEX-labelled 35-mer (10 nM), then a 10X excess of unlabelled 21-mer (100 nM) was added. The complexes containing two labelled 35-mers, one labelled 35-mer and one unlabelled 21-mer, and the free labelled 35-mer were then resolved on a polyacrylamide gel Time (hours) * * * * 1) Gel-shift: Dissociation of DNA from Sfi-DNA Complex Substrate: 21-mer & 35-mer: HEX-TCGATCCATGTGGCCAACAAGGCCTATTTGTCGAT AGCTAGGTACACCGGTTGTTCCGGATAAACAGCTA * * * 10-fold Incubate for 1-24 hrs Incubate for 30 min * + * + *

5 Rates of loop formation and dissociation can only be measured under dynamic equilibrium conditions a new approach is needed. Can use catalytically inactive mutants of SfiI that can bind DNA but cannot cleave it. This could also allow binding reactions to be performed in the presence of Mg 2+. The crystal structure of SfiI bound to DNA in Ca 2+ [3] has only one metal ion in its active site, coordinated by D79 and D100, but not in position for catalysis. In contrast, BglI [4] has two metal ions, ideally placed for hydrolysis. In the expectation that D79 and D100 bind the metal ions required for catalysis by SfiI, both residues were mutated to A to give D79A and D100A mutants. T T G Asp79 Asp100 Lys102 Ca 1 2+ Glu55 SfiI Catalytically Inactive Mutants Lys144 T A A Asp116 Asp142 Glu87 Ca Ca 1 2+ Lys144 GGCCTTGTTGGCC GCCTAATAGGC (x1) Pictures by Dr Richard Sessions

6 WT D79A D100A Cut 2 sites Cut 1 site Activities of D79A & D100A were tested by adding 5 nM enzyme to 5 nM DNA (2 SfiI sites) in Mg 2+ - buffer at 50 ºC. No cleavage was observed with either mutant, even after overnight incubation. Activity and Binding of D79A and D100A Mutants Substrate 35-mer D100A WT 21-mer DNA binding was analysed by gel shift. WT SfiI or D100A (D79A not shown) were added to the 21-mer and 35-mer in varied ratios, from 100% 21-mer to 100% 35-mer. Across this range, three DNA-protein complexes were observed: with two 21-mers; one 21-and one 35-mer; two 35-mers. In addition, AUC data (not shown) shows that both mutants are tetramers. Hence, like the WT, D79A and D100A are tetramers that bind two cognate sites. Substrate

7 Time (hours) * * * * Dissociation in Ca 2+ - D100A Double exponential (amplitudes in brackets) : k 1 = 8.1 h -1 (33%); k 2 = 0.92 h -1 (67%) A B C Time (hours) [Labelled DNA] (nM) A B C Gel shifts were performed, as with WT SfiI, to follow the dissociation of DNA from D100A. Unlike the WT, dissociation of the labelled DNA was observed. The gels were analysed with respect to the labelled DNA using ImageQuant, and the decrease in the concentration of complex with two labelled 35-mers was fitted to both a single (red) and double (blue) exponential. Reduced 2 values for single and double exponential are and x double exponential is a much better fit Single exponential: k = 3 h -1

8 Dissociation in Ca 2+ - Modelling The reactions of the pathway were modelled in Berkeley Madonna by numerical integration. This revealed the decrease in EA 2 is a single exponential process. Hence, this scheme doesnt account for the dissociation kinetics observed above. A scheme was derived for the binding reactions of SfiI. Labelled DNA (A) may dissociate from the EA 2 complex to give first EA and then free E. However, the addition of excess unlabelled DNA (B) can generate first a complex with one labelled and one unlabelled DNA (EAB) and then one with two unlabelled DNA molecules (EB 2 ). Slow conversion of an alternative conformation of the SfiI-DNA complex, E*A 2, to EA 2, results in slow dissociation of DNA If an extra step is included, the formation of E*A 2 by a conformational change in EA 2, the decrease in EA 2 is double exponential when k -x

9 For D100A and D79A, E:DNA complexes were formed by mixing 25 nM enzyme and 50 nM Alexa mer. Then a 10X excess of unlabelled 21-mer was added. The decrease in FRET was fitted to either a single (red) or double (blue) exponential. FRET: Dissociation in Ca 2+ k 1 = 6.7 h -1 (43%) k 2 = 0.57 h -1 (57%) k 1 = 28 h -1 (23%) k 2 = 1.4 h -1 (77%) D79A D100A Trp250 Trp85 85 Å 30 Å Dissociation of DNA from the SfiI-DNA complex was also followed by FRET. The intrinsic Trp fluorescence of SfiI (3 Trps/subunit) was exploited for DNA-protein FRET, using a 21 bp oligo labelled at its 5 end with Alexa350. On exciting the Trps at 290 nm, an increase in the emission from the Alexa mer was observed. Addition of excess unlabelled oligo then resulted in a decrease in FRET. 2) DNA – Protein FRET Trp232

10 FRET: Association and Dissociation in Mg 2+ FRET was also used to follow association and dissociation in Mg 2+ -buffer. For the association reactions, E (12.5 – 250 nM D79A or D100A) was titrated against fixed [DNA] (20 nM Alexa mer) in the stopped-flow. Dissociation reactions were performed as above. D79A D100A k 1 = 15 h -1 (28%) k 2 = 0.91 h -1 (72%) k 1 = 0.2 s -1 (85%) k 2 = 0.04 s -1 (15%) In Mg 2+, DNA binds more weakly to D79A than to D100A and dissociates much faster (50-fold) from D79A than from D100A. BINDING DISSOCIATION 250 nM 125 nM 50 nM 12.5 nM 250 nM 125 nM 50 nM 12.5 nM

11 TPM tracks the Brownian motion of a bead tethered by a single DNA molecule by video microscopy. Changes in DNA length caused by looping causes a change in Brownian motion, which is monitored by measuring the RMS motion of the bead. The motion of unlooped tethers is larger than the looped. For example, data from another looping enzyme, NaeI [5]: 3) Tethered Particle Motion (TPM) DIG BIO ~ 250 bp ~ 500 bp SfiI1SfiI2 Glass surface ANTI-DIG DIG BIOTIN Streptavidin- coated bead UnloopedLooped RMS motion (nm): The lifetime of the loop and the loop formation time can be determined from the time spent in the looped and unlooped states. In addition, the association rate of E and DNA can be measured at low [E] from the time taken to form a loop after adding the enzyme. A DNA substrate was designed for SfiI with biotin at one end (to attach to the bead) and digoxygenin (DIG) at the other (to attach to the glass surface): Looped Unlooped

12 SfiI flown into the flow chamber SfiI forms a loop in the DNA RMS (nm) t (min) 0.5 sec filtered data trace Binary trace # counts TPM experiments were performed in Ca 2+ for WT SfiI, D79A & D100A. For all three enzymes, loops were formed but not released, even after 40 mins (not shown). This is consistent with the gel-shift and fluorescent data. WT SfiI, D79A & D100A in Ca 2+ With D79A in Mg 2+, transitions between the two distinct RMS states occur over the minute time-scale. Hence under these conditions dynamic looping is observed. This agrees with the solution kinetics, which showed that, in Mg 2+, D79A binds DNA weakly and dissociates from it rapidly. D79A in Mg nM D100A in Mg 2+ : k on ~ 10 8 M -1 s - 1 Unlooped Looped In Mg 2+, D100A again formed loops that never dissociated, also matching the solution kinetics. At low [D100A], the association rate (k on ) of E and DNA was measured and found to be near the diffusion controlled limit. D100A in Mg 2+

13 D79A in Mg 2+ - Loop Formation and Duration The loop formation time ( form ) is a double exponential process: [D79A] (nM) off form1 form ± ± ± ± ± ± ± ± ± 0.02 Analysis of measured loop duration times reveals that loop dissociation is a single exponential process, giving a lifetime of the D79A-DNA looped complex ( off ) of 20 s. This corresponds to a loop dissociation rate (k off ) of 0.05 s -1, similar to other Type II enzymes [5]. Long time constant form1 - dependent on [E] SfiI in free solution binding to either of the two sites on the DNA dependent on the diffusion of enzyme to the DNA molecule Short time constant form2 - independent of [E] SfiI already bound at one site capturing the second site in cis dependent on the segmental diffusion of the DNA

14 DNA release Unlooped DNA Looped DNA WT SfiI in Mg 2+ TPM can also be used to study the turnover of DNA by WT SfiI in Mg 2+ -buffer at 25 ºC. The release of the bead is monitored, which occurs when SfiI has cut the DNA and released the ends. Hence, this assay should measure product release rather than hydrolysis. Fraction of non-cleaved tethers vs time: The decrease in the fraction of non-cleaved tethers over time is a single exponential, with a time constant of ~50 min, giving a bead release rate of 0.02 min -1. From previous kinetic studies on DNA cleavage by SfiI at 25 ºC [6], the rate constant for the hydrolytic step is ~30 min -1, very much faster than the bead release rate, while that for subsequent dissociation of the cleaved product is ~0.01 min -1, in good agreement with the bead release rate. TPM is a fair representation of solution kinetics

Download ppt "Stuart R.W. Bellamy 1, Yana S. Kovacheva 1, Ishan Haji Zulkipi 1, Guus Harms 2, Niels Laurens 2, Gijs J.L. Wuite 2, Stephen E. Halford 1. The Dynamics."

Similar presentations

Ads by Google