1. Rapid taxonomic classification of complex consortia of environmental rDNA using a microarray. CEB - ESD - LBNL Todd DeSantis, Sonya Murray, Jordan Moberg, Gary Andersen Carol Stone (DSTL, U.K.) What bugs are in my sample?

2. The ponderings of a toddler Why must Mom confiscate my “Hello Kitty” blanket on laundry day? Will the swings be wet at the park? How will this sausage impact the diversity in my lower G.I. bacterial community? Will I inhale any archaeal microorganisms when I visit the hot springs? Gianna DeSantis

3. Every discarded water sample, geological core, or spent air filter is lost data. But who wants to do all the work? –Culture? Anaerobes? non-cultivable? Safety? –Analysis of nucleic acids isolated from environment Must classify or sort heterogeneous nucleic acids into bins. –Restriction Fragment Length Polymorphisms (RFLP) –Single Stranded Conformation Polymorphisms (SSCP) –Temp/Denat Gradient Gel Electrophoresis (T/DGGE) –Sequencing »Provides taxonomic nomenclature »estimates the relative abundance »Need to create, clone, & process hundreds of samples Can we create a simple, comprehensive (quantitative?) microbial test?

4. Project Overview Goal –Create a single microarray capable of detecting and categorizing the bacteria in a complex sample. Approach –GeneChip targeted at 16S rDNA sequence variations to distinguish taxa.

5. The Ribosome rDNA rRNA (functional molecule) LSU SSU 16s or 18s

6. Foundations: –Maintain the largest 16S gene library (~83,000). –Cluster sequences into taxa (~8,000). –Create algorithm for picking probes for each taxa (~500,000).

7. cctagcatgCattctgcata cctagcatgGattctgcata MATCH MISMATCH Build custom Affymetrix  GeneChip Massive parallelism – up to 2 million probes upon a 1.28 cm 2 glass surface. Identification of multiple species in a mixed population Pair each probe with a “mismatch” control probe.

8. General Protocol Air Soil Feces Blood Water rRNA gDNA Universal 16S rDNA PCR Contains probes adhered to glass surface in grid pattern.

9. Overview of Sample Preparation using a Modified Affymetrix Protocol 18 µ ACGGTCGAACGGTCGA ACGGTCGAACGGTCGA ACGGTCGAACGGTCGA ACGGTCGAACGGTCGA ACGGTCGAACGGTCGA Hybridize PCR Amplify DNA Fractionate DNA End-label with biotin Extract Genomic DNA

10. Progress in Miniaturization GeneChip 3000 scanner 16S Microarray

11. 500,000 Probe 16S array (DOE 16S Chip)

12. ParameterFrankiaClostridium Positive fraction1.000.64 Average difference3720625 Frankia sp. str. G48 PM MM Clostridium butyricum

13. BASIS EPA (127 OTUs displayed) High confidence bacterial species detection with 500K probe microarray: - Greater microbial diversity in EPA samples

14. ...CGTAAAGCTCTGTCTTTGGGGAAGATAATGACGGTACCCAAGGAGGAAGCCACGGCTAACT... C. perf. str.CPN50................................................................... C. perf. resistant................................................................... Clostridium sp. AB&J................................................................... clone p-4636-2Wa2................................................................... C. perf. A................................................................... C. perf rrnA................................................................... C. perf rrnE.................................T................................. C. perf rrnD................................................................... C. perf rrnC................................................................... C. perf rrnB................................................................... C. perf rrnF................................................................... C. perf rrnG................................................................... C. perf str.13a................................................................... C. perf str.13b................................................................... C. perf rrnH................................................................... C. perf rrnI................................................................... C. perf rrnJ................................................................... clone OI1612................................................................... C. perf. B................................................................... Swine manure 37-3................................................................... Swine manure 37-4 TAAAGCTCTGTCTTTGGGGAAGATA tacccaaggaggaagccacggctaa AAAGCTCTGTCTTTGGGGAAGATAA AAGCTCTGTCTTTGGGGAAGATAAT AGCTCTGTCTTTGGGGAAGATAATG Bacteria CFB Cyan Proteo Gram + High G+C Bacil-Strep Clostridium C.BOTULINUM_SUBGROUP C.THERMOBUTYRICUM_SUBGROUP C.BARATI_SUBGROUP C.CADAVERIS C.ALGIDICARNIS C.PERFRINGENS C.AURANTIBUTYRICUM C. BUTYRICUM 16S rDNA Probes 5 - 8 5678 27 1492 420469 Ave Diff =1891 C. perfringens probe set identified in EPA sample 22 (N.Y.C., Spring)

15. -- ARCHAEA (1) ---- EURYARCHAEOTA (1.1) ------ METHANOMICROBACTERIA_AND_RELATIVES (1.1.3) -------- HALOPHILIC_ARCHAEA (1.1.3.4) ---------- NTC.AMYLOLYTICUS_SUBGROUP (1.1.3.4.6) (Natronococcus) 1.1.3.4.6.32228 OTU 6 seqs prokMSA_id:649 AB012049 str. MSP1 prokMSA_id:650 AB012052 str. MSP11 prokMSA_id:653 AB012055 str. MSP16 prokMSA_id:654 AB012056 str. MSP17 prokMSA_id:655 AB012057 str. MSP22 prokMSA_id:656 AB012058 str. MSP23 Developing Microarray Experiment Browser

16. 434  -proteobacteria taxa 2250306000000.030_stAcidobacterium capsulatum+ 2280208040000.041_stBordetella pertussis+ 2280209041300.025_stAcidovorax avenae+ 2280210040000.040_stBurkholderia graminis+ 2280210060000.007_stBurkholderia cepacia+ 2280211000000.071_stOxalobacter formigenes+ 2280299000000.001_stRalstonia solanacearum+ 2280308990000.001_stStenotrophomonas maltophilia+ Clean Filter -extracted -amplified -fragmented -labeled -hybridized Example of detection with the  - proteobacteria Sub- division Many of the detected taxa also contain "Environmental clone” members. What’s in a “blank” sample?

17. Testing the effects of variation in hybridization temperature All 3 conditions allowed spikes to be detected. 48deg hybridization permitted the least additional taxa to be reported. Create synthetic community of 16S amplicons. A. capsulatum Y. pestis C. jejuni S. aureus B. anthracis S. typhi B. melitensis R. prowazekii B. subtilis E. coli Separately culture, gDNA-extract, and PCR-amplify. Combine PCR products.

18. Testing the effects of variation in hybridization temperature All 3 conditions allowed spikes to be detected. 48deg hybridization permitted the least additional taxa to be reported.

19. C. jejuni probe sets 45 deg C48 deg C50 deg C 2280503040000.010d_st301522191927 2280503040000.010c_st301123032126 2280503040000.010b_st316623972548 2280503040000.010_st316223202291 mean:308823092223 standard deviation:8773263 coefficient of variation:0.03 0.12 Reproducibility  Probes for C. jejuni tiled in 4 areas

20. Columbus, OH

21. Quantitative Considerations -Spike environmental samples with defined amplicons. - Calibrate - Pearson’s corr coefficient was significant (df=18). - 95% confidence intervals plotted.

22. Environmental community is measured with confidence intervals. Conf Interval: Conc  (t(RSE)/b)(1/m+1/n+((Y-y) 2 ) / (b 2 (n-1)s x 2 )) b = slope from regression Y = mean of 6 replicate measurements m = number of repeat measurements = 6 y = mean of the HybScores for the 20 points used for calibration t = critical value obtained from t-table for 18 d.f. for 95% = 1.734 RSE = residual standard error of calibration points = 0.56 s x = standard deviation of the conc. for the 20 points used for calibration

23. Current projects -Netherlands soil bioremediation tracking -BioWatch – DHS metropolitan air microbe survey -G.I. community comparison -Root-soil interface -Does polymerase brand affect perceived community?

24. Takara PCR Applied Bio PCR PCR Enzyme Comparison Biowatch gDNA + + neg

25. Summary The rDNA microarray is able to rapidly quantify and taxonomically classify complex consortia of rDNA amplicons. You can collect data on over 8,000 taxa simultaneously.

26. Acknowledgements Gary Andersen – Group Leader Carol Stone – UK sample collection, hybridization Sonya Murray – sample preparation, hybridizations, manuscript composition Jordan Moberg – sample preparation, sample tracking database, parameter optimization.