1. From the Gene to the Genome Genetic Inheritance Patterns Observing Genetic Differences in the DNA

2. Each human has 46 chromosomes. Each parent provides one member of a matched (homologous) chromosome pair.

3. Chromosomal Locations of Genes Locus = area on chromosome where gene is locatedLocus = area on chromosome where gene is located Paired chromosomes have genes in the same order, but may have different forms of a gene at the same locusPaired chromosomes have genes in the same order, but may have different forms of a gene at the same locus Alleles = alternative forms of a geneAlleles = alternative forms of a gene –Dominant allele masks other alleles –Recessive allele is masked Gene = sequence of DNA that codes for a protein, gives rise to physical traitGene = sequence of DNA that codes for a protein, gives rise to physical trait Locus 1 Locus 2 Locus 3

4. Separation of Chromosome Pairs W w Chromosomes duplicate Pairs separate Duplicates separate dominant allele recessive allele Each sex cell will carry only one allele for each gene ww W W ww W WW w W w Duplicates separate

5. Inheritance Pattern for One Gene (for genes on pairs 1-22) TT or Tt = no disease tt = Tay-Sachs disease Donald, no disease Darla, no disease TtTt T t T t TT Tt Tt tt Chances with each pregnancy: 75% no disease 25% Tay-Sachs disease phenotype = physical characteristic homozygous recessive homozygous dominant heterozygous (carrier) genotype = set of alleles

6. Molecular Basis for Effects of Dominant and Recessive Alleles Dominant AlleleDominant Allele –codes for a functional protein –eg. T allele gives instructions for making Hexosaminidase A (Hex A), an enzyme involved in lipid metabolism Recessive AlleleRecessive Allele –codes for a non-functional protein or prevents any protein product from being formed –eg. with the t allele, no functional Hex A is detected

7. Variations in Genetic Patterns: Codominance Neither allele masks the other so that effects of both alleles are observed in heterozygotes without blending Example: ABO Blood Type Blood Type Genotypes Type A AA or Ao Type B BB or Bo Type AB AB Type O oo Alleles A and B are codominant. Alleles A and B are completely dominant over o. Effects of both alleles observed in phenotype Type A Type B Type AB Type O

8. Variations in Genetic Patterns: Multiple Alleles Three or more alleles exist for one trait [Note: A person can only carry any two of these alleles at once.] Examples: ABO Blood Type and also Rh Factor PhenotypeGenotype* Protein on Red Blood Cells Rh Positive RR or Rr Rhesus Protein Rh Negative rrNone *Although there are multiple R alleles, R 1, R 2, R 3, etc. all are completely dominant over all of the r alleles, r 1, r 2, r 3, etc. ABO Blood Type and Rh Factor are controlled by separate genes. They are inherited independently.

9. Variations in Genetic Patterns: Polygenic Inheritance Many genes affect one trait Example: Skin color Number of Dominant Alleles Skin Color* (Phenotype)Genotypes % Pigmentation* 0Whiteaabb0-11% 1 Light Black Aabb or aaBb 12-25% 2 Medium Black AAbb or AaBb or aaBB 26-40% 3 Dark Black AABb or AaBB 41-55% 4 Darkest Black AABB56-78% *Based on a study conducted in Jamaica.

10. Variations in Genetic Patterns: Sex Influenced Genes Genes that have different dominance patterns in males and females Example: Pattern Baldness Caused by a dominant allele in males, but a recessive allele in females bb BB or Bb bb

11. Inheritance for Sex-linked Genes (for genes on pair 23) Hemophilic Male Non-hemophilic Female Female XhXhYYXhXhYYY X H X h XHXhXHXhXHXhXHXh XhXhXhXhXhXhXhXh XHYXHYXHYXHY XhYXhYXhYXhY Chance for each pregnancy: ¼ non-hemophilic females; ¼ hemophilic females ¼ non-hemophilic males; ¼ hemophilic males x X H X h Males carry only one copy of genes on the X chromosome Females can be homozygous or heterozygous these genes H = no hemophilia h = hemophilia Gramps X h Y (father is hemophilic) XhYXhYXhYXhY

12. The Human Genome Project: Genetic Differences at the DNA Level Per 23 chromosomes Now estimated at 30,000 genes

13. Studying DNA Cut chromosomal DNA into smaller pieces with restriction enzymesCut chromosomal DNA into smaller pieces with restriction enzymes 5’— A A G T C G G A T C C T G A C G T— 3’ 5’— A A G T C G G A T C C T G A C G T— 3’ 3’— T T C A G C C T A G G A C T G C A— 5’ 3’— T T C A G C C T A G G A C T G C A— 5’ sticky end G A T C C T G A C G T— 3’ G A C T G C A— 5’ G A C T G C A— 5’ 5’— A A G T C G 3’— T T C A G C C T A G Bam H1 Results in separate fragments

14. Studying DNA Cut chromosomal DNA into smaller pieces with restriction enzymesCut chromosomal DNA into smaller pieces with restriction enzymes Separate DNA pieces by size using agarose gel electrophoresisSeparate DNA pieces by size using agarose gel electrophoresis

15. Electric current is applied to separate DNA by size UV light is used to detect a fluorescent dye attached to the DNA fragments Example of a gel pattern DNA samples are placed in an agarose gel

16. Agarose Gel Electrophoresis larger fragments smaller fragments

17. Studying DNA Transfer DNA to filter for analysis with probe that will bind to specific sequenceTransfer DNA to filter for analysis with probe that will bind to specific sequence DNA separated by size is transferred from agarose gel to filter DNA pattern on filter will be identical to gel separation pattern.

18. Studying DNA Probe: sequence of DNA that is complementary to the sequence of interest; Used to locate a copy of the DNA sequence by hybridization Probe: sequence of DNA that is complementary to the sequence of interest; Used to locate a copy of the DNA sequence by hybridization Add Probe Probe Binds to gene AGCTTAGCGATTCGAATCGCTA AATCGC AGCTTAGCGATTCGAATCGCTA Denature DNA by heating

19. DNA Pattern on Gel Pattern on Filter after probe binding

20. Studying DNA Allow probe to bind to DNA on filter, visualize region of probe attachmentAllow probe to bind to DNA on filter, visualize region of probe attachment DNA on filter is exposed to probe to detect complementary sequences.

21. Studying DNA Identify similarities and differences between individuals– Paternity TestingIdentify similarities and differences between individuals– Paternity Testing X X X X X X X X

22. Testing for Sickle Cell Alleles Studying DNA Identify patterns that are unique to specific genes– Medical Genetic TestingIdentify patterns that are unique to specific genes– Medical Genetic Testing On the basis of this analysis, the genotype of the fetus is 1. AS 2. AA 3. SS 4. Unknown

23. Future Directions: Gene Therapy Andrew Gobea Ashanthi DeSilva Treated for SCID Severe Combined Immune Deficiency