Presentation is loading. Please wait.

Presentation is loading. Please wait.

Introductory Genetics

Similar presentations


Presentation on theme: "Introductory Genetics"— Presentation transcript:

1 Introductory Genetics http://www.stats.gla.ac.uk/~paulj/intro_genetics.ppt

2 Overview of talks This talk: broad overview of genetics Future talks: genetic data analysis –Important general genetic concepts heritability, penetrance, linkage/linkage disequilibrium, Hardy- Weinberg equilibrium –Types of genetic analysis association analysis –family-based vs population-based –candidate gene vs genome scan –genotype v haplotype –problems: population stratification, missing data, data errors, inferring haplotypes twin studies –Omics: genomics, proteomics, metabolomics, genetical genomics, integrative genomics

3 Overview of this talk Why genetics is important How genes work Mendels laws of inheritance for simple genetic traits Post-genomic genetics

4 Why genetics is important

5 G×E interaction HealthGeneticsEnvironment

6

7 How genes work

8 What is a gene? A gene is a stretch of DNA whose sequence determines the structure and function of a specific functional molecule (usually a protein) DNA Protein …GAATTCTAATCTCCCTCTC AACCCTACAGTCACCCATTT GGTATATTAAAGATGTGTTG TCTACTGTCTAGTATCC… Computer program Specific function …function sf(){document. f.q.focus()}… Working copy mRNA

9 Genes are located in the cell nucleus on chromosomes Karyotype

10 Down syndrome karyotype (trisomy 21)

11 DNA (deoxyribonucleic acid) mRNA Protein

12

13 Transcription movie

14 Translation

15

16

17 Translation movie

18 Gene expression movie

19 Summary A gene is a length of DNA that contains instructions for making a specific protein Genes are arranged along 23 pairs of chromosomes in the cell nucleus Genes work by specifying the amino acid sequence of a protein

20 Mendels laws

21 Genetic knowledge used for 1000s of years: agriculture

22 Patterns of disease inheritance known for 1000s of years, e.g. haemophilia

23 Mendel deduced the underlying principles of genetics from these patterns 1.Segregation 2.Dominance 3.Independent assortment

24 Mendels experiments

25 Mendels data

26 Mendels law of segregation A normal (somatic) cell has two variants (alleles) for a Mendelian trait. A gamete (sperm, egg, pollen, ovule) contains one allele, randomly chosen from the two somatic alleles. E.g. if you have one allele for brown eyes (B) and one for blue eyes (b), somatic cells have Bb and each gamete will carry one of B or b chosen randomly. Bb BBBBb b bb Eggs Sperm

27 Mendels law of dominance If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive. Bb BBBBb b bb Eggs Sperm

28 Mendels law of dominance If your two alleles are different (heterozygous, e.g. Bb), the trait associated with only one of these will be visible (dominant) while the other will be hidden (recessive). E.g. B is dominant, b is recessive. Bb BBBBb b bb Eggs Sperm

29 Terminology… Haploid: containing one copy of each chromosome (n=23) Bb BBBBb b bb Eggs Sperm Diploid: containing two copies of each chromosome (2n=46)

30 Terminology… Genotype: the states of the two alleles at one or more locus associated with a trait Phenotype: the state of the observable trait GenotypePhenotype BB (homozygous)Brown eyes Bb (heterozygous)Brown eyes bb (homozygous)Blue eyes

31 Mendels law of independent assortment Knowledge of which allele has been inherited at one locus gives no information on the allele has been inherited at the other locus S/sY/y SYSySysYsYsy 25%

32 Mendels law of independent assortment SY sy Gametophytes (gamete- producing cells) SY sy Gametes Ab aB Recombinants Segregation

33 Mendels law of independent assortment SY sy Gametophytes (gamete- producing cells) SY sy Gametes Sy sY Recombinants Recombination Segregation

34 Statistical aside: Mendels data too good to be true?

35 Simplified view of eye colour inheritance: biallelic Mendelian trait –Brown dominant: BB, Bb –Blue recessive: bb Human eye colour Bb BBBBb b bb Eggs Sperm

36 Human eye colour ? What is the probability of a child being born with blue eyes?

37 Human eye colour ?

38 ? B? bb B?

39 Human eye colour ? Bb B?bb B?

40 Human eye colour ? Bb B?

41 Human eye colour ? Bb P(BB)=1/3 Bb P(Bb)=2/3

42 Human eye colour ? Bb P(BB)=1/3 Bb P(Bb)=2/3 P(b)=2/3x1/2=1/3P(b)=1/2

43 Human eye colour ? Bb P(BB)=1/3 Bb P(Bb)=2/3 P(b)=2/3x1/2=1/3P(b)=1/2 P(bb)=1/3x1/2=1/6

44 Haemophilia A Males with a mutant gene are affected Females with one mutant gene are unaffected carriers Non-Mendelian inheritance: Haemophilia

45 Non-Mendelian inheritance: additive traits

46 Brown eye colour is dominant

47 Non-Mendelian inheritance: additive traits Snapdragon red colour is additive

48 Non-Mendelian inheritance: polygenic traits

49

50

51 For example, height

52 Non-Mendelian inheritance: mtDNA

53 Phenotypes associated with mtDNA mutations Longevity Optic neuritis Occipital stroke in migraine Asthenozoospermia Migraine without aura Cyclic vomiting syndrome Bipolar disorder Athletic performance

54 Summary Mendel deduced three simple laws of inheritance: –Segregation –Dominance –Random assortment The majority of traits dont follow these rules but Mendels laws are nevertheless crucial to understanding almost all genetic inheritance

55 Post-genomic genetics

56 Human Genome Project Sequenced almost all 3 billion DNA base pairs (2003) Current work includes: –ENCODE Project (ENCyclopedia Of DNA Elements) to characterise functional elements in genome 20,000-25,000 genes (1.5% of genome) The bits in between (98.5% of genome) –Characterise human DNA sequence variation Find and describe DNA sequence variation (International HapMap Project) Find significance of sequence variation (e.g. contribution to complex diseases)

57 HapMap project

58 Frequency Case0.200 Control0.165 Odds ratio: 1.26

59 1.Eye-catching headline of the form Gene for… 2.Highly qualified factual paragraph

60 HTR1D

61

62 Summary Post-genomic genetics has enormous promise for tracking down the genes involved in common complex diseases Currently our ability to exploit this potential is limited by –study size –difficulty of correcting for confounding factors


Download ppt "Introductory Genetics"

Similar presentations


Ads by Google