Presentation is loading. Please wait.

Presentation is loading. Please wait.

Genetic Technologies

Similar presentations


Presentation on theme: "Genetic Technologies"— Presentation transcript:

1 Genetic Technologies

2 Overview Why learn about genetic technologies? The molecular geneticists toolkit Genetic markers Microarray assays Telomeres RNA interference (RNAi)

3 Why learn about genetic technologies?

4 We need to understand the processes that generated the data Understanding of biology obviously necessary Understanding of lab techniques will enhance our ability to assess data reliability Errors in any measurement can lead to loss of power or bias Some genetic analyses are particularly sensitive to error because –they depend on the level of identity between DNA sequences shared by relatives –the more data is collected, the greater the chance of false differences

5 Why learn about genetic technologies? A B Genotype 177, , 179 Individual What is the probability that the observed genotype is wrong? Is this probability the same for all observed genotypes? What impact will a realistic range of errors have on power?

6 The molecular geneticists toolkit

7 Most genetic technologies are based on four properties of DNA 1.DNA can be cut at specific sites (motifs) by restriction enzymes 2.Different lengths of DNA can be size-separated by gel electrophoresis 3.A single strand of DNA will stick to its complement (hybridisation) 4.DNA can copied by a polymerase enzyme DNA sequencing Polymerase chain reaction (PCR)

8 Restriction enzymes cut double-stranded DNA at specific sequences (motifs) E.g. the enzyme Sau3AI cuts at the sequence GATC Most recognition sites are palindromes: e.g. the reverse complement of GATC is GATC Restriction enzymes evolved as defence against foreign DNA DNA can be cut at specific sites (motifs) by an enzyme Sau3AI

9 ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA DNA can be cut at specific sites (motifs) by an enzyme

10 Sau3AI ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA DNA can be cut at specific sites (motifs) by an enzyme

11 Sau3AI ACTGTCGATGTCGTCGTCGTAGCTGCT GATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAG CATCGATCGA DNA can be cut at specific sites (motifs) by an enzyme

12 ACTGTCGATGTCGTCGTCGTAGCTGCT TGACAGCTACAGCAGCAGCATCGACGACTAG GATCGTAGCTAGCT CATCGATCGA ACTGTCGATGTCGTCGTCGTAGCTGCTGA TGACAGCTACAGCAGCAGCATCGACGACT TCGTAGCTAGCT AGCATCGATCGA DNA can be cut at specific sites (motifs) by an enzyme

13 Different lengths of DNA can be separated by gel electrophoresis DNA is negatively charged and will move through a gel matrix towards a positive electrode Shorter lengths move faster

14 Different lengths of DNA can be separated by gel electrophoresis DNA is negatively charged and will move through a gel matrix towards a positive electrode Shorter lengths move faster

15 Different lengths of DNA can be separated by gel electrophoresis Slow: 41 bp ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA Medium: 27 bp ACTGTCGATGTCGTCGTCGTAGCTGCT TGACAGCTACAGCAGCAGCATCGACGACTAG Fast: 10 bp GATCGTAGCTAGCT CATCGATCGA F M S

16 Different lengths of DNA can be separated by gel electrophoresis Recessive disease allele D is cut by Sma3AI: ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA Healthy H allele is not cut: ACTGTCGATGTCGTCGTCGTAGCTGCTGAGCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTCGCATCGATCGA F M S HHHD DD

17 Different lengths of DNA can be separated by gel electrophoresis F M S HHHD DD

18 A single strand of DNA will stick to its complement ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

19 A single strand of DNA will stick to its complement 60°C ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

20 A single strand of DNA will stick to its complement 95°C ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

21 A single strand of DNA will stick to its complement 60°C ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

22 A single strand of DNA will stick to its complement Fragment length in bp Fragment frequency Flourescence

23 A single strand of DNA will stick to its complement

24 Southern blotting (named after Ed Southern)

25 A single strand of DNA will stick to its complement Southern blotting (named after Ed Southern)

26 A single strand of DNA will stick to its complement

27

28

29 DNA can copied by a polymerase enzyme ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA

30 DNA can copied by a polymerase enzyme ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA DNA polymerase C C C C C C G G G G G G G G G T T T T A T T A A A A A A A A

31 DNA can copied by a polymerase enzyme ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA DNA polymerase C C C C C C G G G G G G G G G T T T T A T T A A A A A A A A

32 DNA can copied by a polymerase enzyme ACTGTCGATGTCGT

33 DNA can copied by a polymerase enzyme ACTGT ACTGTCGAT ACTGTCGATGT ACTGTCGATGTCGT ACTGTCGATGTCGTCGT ACTGTCGATGTCGTCGTCGT ACTGTCGATGTCGTCGTCGTAGCT ACTGTCGATGTCGTCGTCGTAGCTGCT ACTGTCGATGTCGTCGTCGTAGCTGCTGAT ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGT ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCT ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT

34 DNA can copied by a polymerase enzyme ACTGTCGATGT ACTGTCGATG ACTGTCGAT ACTGTCGA ACTGTCG ACTGTC ACTGT Fluorescence Time Fluorescence Time TGTAGCTTGTAGCT T C G A T G T etc

35 DNA can copied by a polymerase enzyme

36

37

38 Polymerase chain reaction (PCR) A method for producing large (and therefore analysable) quantities of a specific region of DNA from tiny quantities PCR works by doubling the quantity of the target sequence through repeated cycles of separation and synthesis of DNA strands

39 DNA can copied by a polymerase enzyme

40 A C T G DNA template Heat resistant DNA polymerase G, A, C, T bases Forward primer Reverse primer A thermal cycler (PCR machine)

41 DNA can copied by a polymerase enzyme

42

43

44 PCR can generate 100 billion copies from a single DNA molecule in an afternoon PCR is easy to execute The DNA sample can be pure, or it can be a minute part of an extremely complex mixture of biological materials The DNA may come from – a hospital tissue specimen –a single human hair –a drop of dried blood at the scene of a crime –the tissues of a mummified brain –a 40,000-year-old wooly mammoth frozen in a glacier. In the words of its inventor, Kary Mullis…

45 DNA can copied by a polymerase enzyme

46 The molecular geneticists toolkit Specific DNA-cutting restriction enzymes DNA size separation by gel electrophoresis Hybridisation using labelled DNA probes Synthesis of DNA using DNA polymerase (PCR)

47 Genetic markers

48 What are they? –Variable sites in the genome What are their uses? –Finding disease genes –Testing/estimating relationships –Studying population differences

49 Eye colour PhenotypeGenotype Brown eyesBB or Bb Blue eyesbb

50 ABO blood group PhenotypeGenotype AB AAA or AO BBB or BO OOO

51 The ideal genetic marker Codominant High diversity Frequent across whole genome Easy to find Easy to assay

52 Modern genetic markers: SNPs SNPs are single nucleotide polymorphisms Usually biallelic, and one allele is usually rare Can be protein-coding or not This example is a T/G SNP. An individual can be TT, TG, GG Healthy allele A is cut by Sma3AI: ACTGTCGATGTCGTCGTCGTAGCTGCTGATCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTAGCATCGATCGA Recessive disease B allele is not cut: ACTGTCGATGTCGTCGTCGTAGCTGCTGAGCGTAGCTAGCT TGACAGCTACAGCAGCAGCATCGACGACTCGCATCGATCGA

53 Modern genetic markers: SNPs OLA: oligonucleotide ligation assay Allele-specific oligonucleotide Clin Biochem Rev (2006) 27: 63–75

54 Modern genetic markers: SNPs

55 No error2% error Common homozygote Heterozygote4050 Rare homozygote111

56 Modern genetic markers: SNPs Clin Biochem Rev (2006) 27: 63–75

57 Modern genetic markers: SNPs ARMS: amplification refractory mutation system Clin Biochem Rev (2006) 27: 63–75

58 Modern genetic markers: SNPs OLA: oligonucleotide ligation assay Clin Biochem Rev (2006) 27: 63–75

59 Modern genetic markers: SNPs Molecular beacon probes Clin Biochem Rev (2006) 27: 63–75

60 Modern genetic markers: SNPs Pyrosequencing Clin Biochem Rev (2006) 27: 63–75

61 Modern genetic markers: microsatellites Microsatellites are short tandem repeats (STR, also SSR) Usually high diversity Usually not in protein coding sequence This example is an (AC) n repeat; a genotype is usually written n,n With k alleles there are k(k+1)/2 possible unordered genotypes ACTGTCGACACACACACACACGCTAGCT (AC) 7 TGACAGCTGTGTGTGTGTGTGCGATCGA ACTGTCGACACACACACACACACGCTAGCT (AC) 8 TGACAGCTGTGTGTGTGTGTGTGCGATCGA ACTGTCGACACACACACACACACACACGCTAGCT (AC) 10 TGACAGCTGTGTGTGTGTGTGTGTGTGCGATCGA ACTGTCGACACACACACACACACACACACACGCTAGCT (AC) 12 TGACAGCTGTGTGTGTGTGTGTGTGTGTGTGCGATCGA ,7 87,88,8 97,98,99,9 127,128,129,1212,12

62 Modern genetic markers: microsatellites

63

64

65

66 Microsatellites versus SNPs MicrosatellitesSNPs CodominantYes DiversityHighLow Frequent10,000s3 million Easy to assayYes Easy to findNoNo, but…

67 Uses of SNPs and microsatellites SNPs –The HapMap project has discovered millions of SNPs –Their high density in the genome makes them ideal for association studies, where markers very close to disease genes are required Microsatellites –More suitable for family-based studies, where high variation is valuable and lower levels of resolution are required

68 Overview Why learn about genetic technologies? The molecular geneticists toolkit Genetic markers Microarrays Telomeres RNA interference (RNAi)

69 The molecular geneticists toolkit Specific DNA-cutting restriction enzymes DNA size separation by gel electrophoresis Hybridisation using labelled DNA probes Synthesis of DNA using DNA polymerase (PCR)

70 Overview Why learn about genetic technologies? The molecular geneticists toolkit Genetic markers Microarrays Telomeres RNA interference (RNAi)

71 Microarrays

72 Gene expression Transcription: –DNA gene mRNA –in nucleus Translation: –mRNA protein –in cytoplasm Microarrays use mRNA as a marker of gene expression Nucleus Cytoplasm

73 What are microarrays? A microarray is a DNA chip which holds 1000s of different DNA sequences Each DNA sequence might represent a different gene Microarrays are useful for measuring differences in gene expression between two cell types They can also be used to study chromosomal aberrations in cancer cells

74 Principles behind microarray analysis Almost every body cell contains all ~25,000 genes Only a fraction is switched on (expressed) at any time in any cell type Gene expression involves the production of specific messenger RNA (mRNA) Presence and quantity of mRNA can be detected by hybridisation to known RNA (or DNA) sequences

75 What can microarray analysis tell us? Which genes are involved in –disease? –drug response? Which genes are –switched off/underexpressed? –switched on/overexpressed?

76 Before microarrays: northern blotting Extract all the mRNA from a cell Size-separate it through a gel Measure level of expression using a probe made from your gene of interest

77 Northern blotting: still useful for single-gene studies

78 Microarray analysis: probe preparation

79 Microarray analysis: target preparation

80 Arthritis Research & Therapy 2006, 8:R100

81 Microarrays can be used to diagnose and stage tumours, and to find genes involved in tumorigenesis Copy number changes are common in tumours Loss or duplication of a gene can be a critical stage in tumour development Chromosome BMC Cancer 2006, 6:96

82 Problems of microarray analysis Gene expression mRNA concentration Easy to do, difficult to interpret Standardisation between labs Lots of noise, lots of genes (parameters) –e.g. p = 10,000 low sample size –e.g. n = 3

83 Telomeres

84 Telomeres and telomerase Telomeres are repetitive DNA sequences at the ends of chromosomes They protect the ends of the chromosome from DNA repair mechanisms In somatic cells they shorten at every cell division, leading to aging In germ cells they are re- synthesised by the enzyme telomerase Telomere Centromere Telomere

85 Why do we need telomeres? At every cell division each chromosome must be replicated DNA is synthesised in one direction only The lagging strand is synthesised backwards in 100–200 bp chunks

86 Leading strand This isnt a problem for the leading strand…

87 Lagging strand …but 100–200 bp of single stranded DNA are left hanging at the end of the lagging strand, and are lost.

88 Terminal (GGGTTA) n repeats buffer DNA loss

89 In germ cells, telomerase rebuilds telomeres

90 Health implications of telomere shortening: aging

91

92 Health implications of telomere shortening: cancer Cancer tumour cells divide excessively, and will die unless they activate telomerase Telomerase activation is an important step in many cancer cell types Telomere length can be used to diagnose tumours Telomerase is a potential target of cancer therapy

93 Measuring telomeres Two principal methods Southern blottingQuantitative PCR (qPCR)

94 Measuring telomeres

95 RNA interference (RNAi)

96 What is RNAi? Generally genes are studied through the effects of knockout mutations in particular experimental organisms RNAi is a quick and easy technique for reducing gene function without the necessity of generating mutants that can be applied to any organism It has the potential to treat diseases caused by over- expression of genes

97 Principles of RNA interference (RNAi) Injection of double-stranded RNA (dsRNA) complementary to a gene silences gene expression by –destruction of mRNA –transcriptional silencing –stopping protein synthesis Gene expression can be switched off in specific tissues or cells by the injection of specific dsRNA

98 RNAi

99

100 Uses of RNAi Investigating role of genes by knocking down (not out) gene expression in specific tissues at specific developmental stages Potential use in gene therapy –macular degeneration: two phase I trials currently under way –therapies being developed for HIV, hepatitis, cancers

101 Limitations of RNAi Target specificity: how do you know the dsRNA isnt interfering with other genes? –Interpretation of results –Risks for gene therapy Function isnt knocked out, its reduced –Knockdown may not reveal gene function –Might not give therapeutic effect


Download ppt "Genetic Technologies"

Similar presentations


Ads by Google