Presentation is loading. Please wait.

Presentation is loading. Please wait.

Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides.

Similar presentations

Presentation on theme: "Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides."— Presentation transcript:


2 Chapter 17 From Gene to Protein

3 Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits by dictating the synthesis of proteins Proteins are the links between genotype and phenotype Gene expression, the process by which DNA directs protein synthesis, includes two stages: transcription and translation

4 Fig How does a single faulty gene result in the dramatic appearance of an albino deer?

5 How was the fundamental relationship between genes and proteins discovered?

6 Evidence from the Study of Metabolic Defects In 1909, Archibald Garrod Genes dictate phenotypes through enzymes Symptoms of an inherited disease reflect inability to synthesize a certain enzyme Linking genes to enzymes required understanding that cells synthesize and degrade molecules in a series of steps, a metabolic pathway

7 Nutritional Mutants in Neurospora: Scientific Inquiry George Beadle and Edward Tatum Created mutants using bread mold that were unable to survive on minimal medium as a result of inability to synthesize certain molecules one gene–one enzyme hypothesis Each gene dictates production of a specific enzyme

8 Fig. 17-2a EXPERIMENT Growth: Wild-type cells growing and dividing No growth: Mutant cells cannot grow and divide Minimal medium

9 Fig. 17-2b RESULTS Classes of Neurospora crassa Wild type Class I mutantsClass II mutants Class III mutants Minimal medium (MM) (control) MM + ornithine MM + citrulline MM + arginine (control) Condition

10 Fig. 17-2c CONCLUSION Class I mutants (mutation in gene A) Class II mutants (mutation in gene B) Class III mutants (mutation in gene C) Wild type Precursor Enzyme A Ornithine Enzyme B Citrulline Enzyme C Arginine Gene A Gene B Gene C

11 Basic Principles of Transcription & Translation RNA is the intermediate between genes and the proteins for which they code Transcription is the synthesis of RNA under the direction of DNA Transcription produces messenger RNA (mRNA) Translation is the synthesis of a polypeptide, which occurs under the direction of mRNA Ribosomes are the sites of translation

12 In prokaryotes, mRNA produced by transcription is immediately translated without more processing In a eukaryotic cell, the nuclear envelope separates transcription from translation Eukaryotic RNA transcripts are modified through RNA processing to yield finished mRNA

13 A primary transcript is the initial RNA transcript from any gene The central dogma is the concept that cells are governed by a cellular chain of command: DNA RNA protein

14 Fig. 17-3a-1 TRANSCRIPTION DNA mRNA (a) Bacterial cell

15 Fig. 17-3a-2 (a) Bacterial cell TRANSCRIPTION DNA mRNA TRANSLATION Ribosome Polypeptide

16 Fig. 17-3b-1 (b) Eukaryotic cell TRANSCRIPTION Nuclear envelope DNA Pre-mRNA

17 Fig. 17-3b-2 (b) Eukaryotic cell TRANSCRIPTION Nuclear envelope DNA Pre-mRNA RNA PROCESSING mRNA

18 Fig. 17-3b-3 (b) Eukaryotic cell TRANSCRIPTION Nuclear envelope DNA Pre-mRNA RNA PROCESSING mRNA TRANSLATION Ribosome Polypeptide

19 The Genetic Code How are the instructions for assembling amino acids into proteins encoded into DNA? There are 20 amino acids, but there are only four nucleotide bases in DNA How many bases correspond to an amino acid?

20 Codons: Triplets of Bases The flow of information from gene to protein is based on a triplet code: a series of nonoverlapping, three-nucleotide words These triplets are the smallest units of uniform length that can code for all the amino acids

21 During transcription, one of the two DNA strands called the template strand provides a template for ordering the sequence of nucleotides in an RNA transcript During translation, the mRNA base triplets, called codons, are read in the 5 to 3 direction Each codon specifies the amino acid to be placed at the corresponding position along a polypeptide

22 Codons along an mRNA molecule are read by translation machinery in the 5 to 3 direction Each codon specifies the addition of one of 20 amino acids

23 Fig DNA molecule Gene 1 Gene 2 Gene 3 DNA template strand TRANSCRIPTION TRANSLATION mRNA Protein Codon Amino acid

24 Cracking the Code All 64 codons were deciphered by the mid- 1960s Of the 64 triplets, 61 code for amino acids; 3 triplets are stop signals to end translation The genetic code is redundant but not ambiguous; no codon specifies more than one amino acid Codons must be read in the correct reading frame (correct groupings) in order for the specified polypeptide to be produced Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

25 Fig Second mRNA base First mRNA base (5 end of codon) Third mRNA base (3 end of codon)

26 Evolution of the Genetic Code The genetic code is nearly universal, shared by the simplest bacteria to the most complex animals Genes can be transcribed and translated after being transplanted from one species to another

27 Fig (a) Tobacco plant expressing a firefly gene (b) Pig expressing a jellyfish gene

28 Transcription from DNA nucleic acid language to RNA nucleic acid language

29 RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded lots of RNAs mRNA, tRNA, rRNA, siRNA… RNADNA transcription

30 3 KINDS OF RNA RIBOSOMAL RNA (rRNA) Made in nucleolus 2 subunits (large & small) Combine with proteins to form ribosomes

31 3 KINDS OF RNA TRANSFER RNA (tRNA) ANTICODON sequence matches CODON on mRNA to add correct amino acids during protein synthesis

32 3 KINDS OF RNA MESSENGER RNA (mRNA) carries code from DNA to ribosomes

33 Synthesis of an RNA Transcript The three stages of transcription: Initiation Elongation Termination Copyright © 2008 Pearson Education Inc., publishing as Pearson Benjamin Cummings

34 Fig. 17-7a-4 Promoter Transcription unit DNA Start point RNA polymerase Initiation RNA transcript 5 5 Unwound DNA Template strand of DNA 2 Elongation Rewound DNA RNA transcript 3 Termination Completed RNA transcript

35 Transcription Making mRNA transcribed DNA strand = template strand untranscribed DNA strand = coding strand same sequence as RNA synthesis of complementary RNA strand transcription bubble Enzyme = RNA polymerase- pries the DNA strands apart and hooks together the RNA nucleotides template strand rewinding mRNA RNA polymerase unwinding coding strand DNA C C C C C C C C CC C G G G G GG GG G G G A A A AA A A A A A A A A T T T T T T T T T T T T UU build RNA 5 3

36 RNA polymerases RNA polymerase 1 only transcribes rRNA genes makes ribosomes RNA polymerase 2 transcribes genes into mRNA RNA polymerase 3 only transcribes tRNA genes each has a specific promoter sequence it recognizes

37 Which gene is read? Promoter region binding site before beginning of gene Transcription factors mediate the binding of RNA polymerase and the initiation of transcription TATA box binding site binding site for RNA polymerase & transcription factors Enhancer region binding site far upstream of gene turns transcription on HIGH

38 Transcription Factors Initiation complex transcription factors bind to promoter region suite of proteins which bind to DNA hormones? turn on or off transcription trigger the binding of RNA polymerase to DNA Transcription

39 Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands U AGGGGGGTTACACTTTTTCCCCAA U U U U U G G A A A CC RNA polymerase C C C C C G G G G A A A A A 5'3'

40 Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns = the junk inbetween sequence eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

41 mRNAs require EDITING before use Message in NOT CONTINUOUS INTRONS are removed Image by Riedell

42 mRNA splicing eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence primary mRNA transcript mature mRNA transcript pre-mRNA spliced mRNA Post-transcriptional processing eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing edit out introns make mature mRNA transcript ~10,000 bases ~1,000 bases

43 Splicing must be accurate No room for mistakes! a single base added or lost throws off the reading frame AUG|CGG|UCC|GAU|AAG|GGC|CAU AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU Met|Arg|Ser|Asp|Lys|Gly|His Met|Arg|Val|Arg|STOP|

44 RNA splicing enzymes snRNPs exon intron snRNA 5'3' spliceosome exon excised intron 5' 3' lariat exon mature mRNA 5' snRNPs small nuclear RNA proteins Spliceosome several snRNPs recognize splice site sequence cut & paste gene

45 mRNA EDITING ALL ENZYMES ARE PROTEINS? RIBOZYMES-RNA molecules that function as enzymes (In some organisms pre-RNA can remove its own introns) PROCESSING RNA SPLICEOSOMES

46 Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments treated as exons

47 A A A A A 3' poly-A tail mRNA 5' 5' cap 3' G P P P As More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap add poly-A tail longer tail, mRNA lasts longer: produces more protein

48 Translation from nucleic acid language to amino acid language

49 How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? ATCG AUCG

50 mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA Met Arg Val Asn Ala Cys Ala protein ? codon

51 The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base wobble- Flexible pairing at the third base of a codon is called wobble and allows some tRNAs to bind to more than one codon Start codon –AUG –methionine Stop codons –UGA, UAA, UAG Why is the wobble good?


53 How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA amino acid tRNA anti-codon codon UAC Met GCA Arg CAU Val

54 Transfer RNA structure Clover leaf structure anticodon on clover leaf end amino acid attached on 3 end

55 Loading tRNA Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily activating enzyme anticodon tRNA Trp binds to UGG condon of mRNA Trp mRNA ACC UGG C=O OH H2OH2O O tRNA Trp tryptophan attached to tRNA Trp C=O O

56 Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits large small EP A

57 Ribosomes Met 5' 3' U U A C A G APE A site (aminoacyl-tRNA site) holds tRNA carrying next amino acid to be added to chain P site (peptidyl-tRNA site) holds tRNA carrying growing polypeptide chain E site (exit site) empty tRNA leaves ribosome from exit site Protein synthesis 2

58 Building a polypeptide Initiation brings together mRNA, ribosome subunits, initiator tRNA Elongation adding amino acids based on codon sequence Termination end codon 123 Leu tRNA Met PEA mRNA 5' 3' U U A A A A C C C AU U G G G U U A A A A C C C A U U G G G U U A A A A C C C A U U G G G U U A A A C C A U U G G G A C Val Ser Ala Trp release factor A AA CC UUGG 3' How translation works

59 Fig Amino end of polypeptide mRNA 5 3 E P site A site GTP GDP E P A E PA GTP Ribosome ready for next aminoacyl tRNA E P A

60 Protein targeting Signal peptide address label Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… start of a secretory pathway

61 Protein Synthesis in Prokaryotes Bacterial chromosome mRNA Cell wall Cell membrane Transcription Psssst… no nucleus!

62 Prokaryote vs. Eukaryote genes Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons eukaryotic DNA exon = coding (expressed) sequence intron = noncoding (inbetween) sequence introns come out!

63 Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed Translation in Prokaryotes

64 Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing SEE PROCESSING VIDEO

65 COMPLETING PROTEINS POLYRIBOSOMES (POLYSOMES) Numerous ribosomes translate same mRNA at same time 3-D folding (1, 2, 3 structure) Chaparonins

66 POST-TRANSLATIONAL MODIFICATIONS Some amino acids modified by addition of sugars, lipids, phosphate groups, etc Enzymes can modify ends, cleave into pieces join polypeptide strands (4 structure) Ex: Made as proinsulin then cut Final insulin hormone made of two chains connected by disulfide bridges


68 Can you tell the story? DNA pre-mRNA ribosome tRNA amino acids polypeptide mature mRNA 5' GTP cap poly-A tail large ribosomal subunit small ribosomal subunit aminoacyl tRNA synthetase EPA 5' 3' RNA polymerase exon intron tRNA

69 Mutations Mutation- change in genetic material of a cell Point Mutations- chemical changes in just one base pair Base-pair substitutions Base-pair insertions or deletions

70 Base Pair Substitutions Base-pair substitution- replacement of one nucleotide and its partner, with another pair of nucleotides silent mutation no amino acid change redundancy in code missense Codes for different amino acid nonsense Codes for a stop codon Slide from Explore Biology by Kim Foglia

71 Point mutation leads to Sickle cell anemia What kind of mutation? Slide from Explore Biology by Kim Foglia Base pair substitution that caused missense mutation

72 Sickle cell anemia Slide from Explore Biology by Kim Foglia

73 Base Pair Insertions or Deletions Frameshift - shift in the reading frame Insertions- adding base(s) Deletions- losing base(s) Frameshift mutation- occur whenever number of nucleotides inserted or deleted are not multiples of three changes everything downstream More damaging at beginning of gene than at end Slide modified from: Explore Biology by Kim Foglia


75 Mutagens Mutagens- physical or chemical agents that interact with DNA in ways that cause mutations Ex. 1920s x-rays discovered to cause genetic changes in fruit flies Application today: preliminary screening of chemicals to identify carcinogens

76 WHAT IS A GENE? Mendels factors determine phenotype T.H. Morgan- genes located on specific chromosomes Beadle and Tatums one gene-one enzyme Became One gene-one polypeptide - Some proteins made of more than one polypeptide chain Ex: hemoglobin has 4 polypeptide chains Now: one gene – one polypeptide or RNA - Not all genes code for proteins

77 DNA Technology Gel electrophoresis- technique that uses gel as a molecular sieve to separate nucleic acids or proteins based on their size, electrical charge, and other physical properties

78 How does it work? Restriction enzymes- enzymes that cut DNA molecules at a limited number of specific locations In nature protect cell from foreign DNA All copies of a particular DNA molecule always yield the same set of restriction fragments when exposed to the same restriction enzyme


Download ppt "Chapter 17 From Gene to Protein Overview: The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides."

Similar presentations

Ads by Google