Presentation is loading. Please wait.

Presentation is loading. Please wait.

Shiv Hiremath, Kirsten Lehtoma, and Jenise M. Bauman

Similar presentations


Presentation on theme: "Shiv Hiremath, Kirsten Lehtoma, and Jenise M. Bauman"— Presentation transcript:

1 Shiv Hiremath, Kirsten Lehtoma, and Jenise M. Bauman
SURVEY FOR THE PRESENCE OF PHYTOPHTHORA CINNAMOMI ON RECLAIMED MINED LANDS IN OHIO CHOSEN FOR RESTORATION OF THE AMERICAN CHESTNUT Shiv Hiremath, Kirsten Lehtoma, and Jenise M. Bauman

2 Backcrossed chestnuts:
Burnham 1988 *7/8 *15/16 * Advanced 15/16

3 Chestnut in Ohio Coal Mine Reclamation:
Fast growth rate Compliment native range Provides a venue for assessment

4 Early Reports: C. dentata mortality
Phytophthora species are causal agents of “ink disease” Its presence in the Appalachian region, has been noticed on chestnut seedlings (Rhoades et al., 2003, 2009; James 2012). Backcrossed chestnuts are not breed for resistance to chestnut ink disease. Jeffers 2009

5 History of Chestnut Ink Disease
Prior to chestnut blight, several Phytophthoras were introduced to the U.S. ( s, Jeffers et al. 2009). Castanea spp. reported dying of unknown causes as early as 1824 (Crandall et al. 1945) Not reported until 1932 (Milburn and Gravatt 1932) Found in all throughout N. America including 28 States of the U.S. Crandall et al. 1945

6 Phytophthora: “Plant Destroyer”
Crown Rot Fruit Rot of Pumpkin Rhododendron Dieback (shoot rot) Bleeding cankers Citrus rot Port-Orchard-Cedar Root Rot Phytophthora cactorum Phytophthora capsici Phytophthora palmivora Phytophthora citricola Phytophthora parasitica Phytophthora lateralis

7 Infamous Phytophthoras…
P. ramorum P. infestans

8 Phytophthora cinnamomi
Symptoms: - Rot of fine feeder roots - Wilts, stem cankers, collar rot - decline in yield and decreased fruit size Host plants: 3000 species Examples: Eucalyptus, Avocados, Pineapples, Rhododendron, Beech, Walnut, Oak, Chestnut

9 Phytophthora cinnamomi Rands
Taxonomic Class: Oomycetes Stramenopiles = flagella hairs Geographic Origin: Southeast Asia Southern Africa First Described: Portugal in 1838 Global Distribution Hardham 2005

10 Infective Structures Sporangia Zoospores Oospores Bar = 25m

11 Disease Cycle

12 Infection Mechanism Zoospore finds host Encysts Direct Penetration

13 Range of Phytophthora in N. America
A survey of soils associated with oak species for the occurrence of Phytophthora Soils sampled from bases of healthy and declining oak trees P. cinnamomi was the most frequently isolated species (69.4%) of the Phytophthoras The absence of P. cinnamomi above the 40ºN latitude Balci et al. 2007

14 Range of P. cinnamomi in Ohio
Survey of Phytophthora species in white oak decline in southern Ohio The most common species was P. cinnamomi P. cinnamomi was more commonly isolated with wet soils The population densities of P. cinnamomi were significantly with declining oaks Balci et al. 2010

15 Study Objective: Survey reclaimed mine sites in southern Ohio for presence of P. cinnamomi Compared sites that were reclaimed under 5 years to those reclaimed 25 years prior Compared two Phytophthora sampling techniques: direct plating and leaf baiting

16 Study Sites YEAR LOCATION SITES METHOD 2008
Greendale, Ohio, Ora Anderson Park 8 Direct plating Ironton District, WNF 6 2009 The Wilds, International Road 4 The Wilds, Lake Trail The Wilds, Site 2 Nelsonville, Ohio 5 2011 The Wilds, Site 1 7 Leaf baiting The Wilds, Forest Site C07 2 New Straitsville, OH 10

17 Ironton District, WNF The Wilds, International Road Nelsonville, Ohio The Wilds, Lake Trail

18 Methods: Direct Plating
Soil was collected at a depth of 4-5 inches Ten grams of soil were diluted in 100 ml dH2O and plated onto PAR(PH)-V8 (Johnson and Curl 1972) Plates were incubated in the dark at 22 oC and examined under a dissecting microscope for the presence hyphae Subcultures were made on the same selective medium to obtain a pure culture. The fungus was allowed to grow for 3 weeks and harvested

19 Methods: Leaf Baiting 250 g of soil from each site was mixed with 1.25 L deionized water American chestnut leaves were floated on the surface of the water After 3-5 days, necrotic areas were examined for sporangia These areas were plated onto PAR(PH)-V8 plates as described above to obtain a pure culture (Balci et al. 2007)

20 Methods: Molecular Identification
Final identification of the fungus was made by sequencing the internal transcribed spacer region of the ribosomal DNA PCR reactions were analyzed on a 0.7% agarose gel Bands produced from the primer pair were isolated from the gel using the Geneclean (MP Biochemicals) Sequences were analyzed in the GENBANK using BLAST Primer Sequence Yph1F 5’CGACCATKGGTGTGGACTTT3’ Yph2R 5’ACGTTCTCMCAGGCGTATCT3’ Ycin3F 5’GTCCTATTCGCCTGTTGGAA3’ Ycin4R 5’GGTTTTCTCTACATAACCATCCTATAA3’ Phytophthora genus-specific(470bp) P. cinnamomi –specific(243bp)

21 Methods: Resulting Gels
Phytophthora genus-specific P. cinnamomi –specific

22 Results: Wayne National Forest
Year Location P. cinnamomi Phytophthora 2008 Ora Anderson Park 0 % Ironton District 2009 Nelsonville, Ohio 2011 New Straitsville, OH 10 % P. cinnamomi was not detected. We found another species, P. citricola. In addition to Phytophthora, we also detected another plant pathogen belonging to the genus Pythium at one of the sites (Ironton District).

23 Results: The Wilds Year Location P. cinnamomi Phytophthora 2009 The Wilds, Grassland 0 % The Wilds, Lake Trail The Wilds, Site 2 2011 The Wilds, Site 1 The Wilds, Forest 50 % We also found P. citricola in the forested site. This indicates that at least some of the Phytophthora species are present in these reclaimed lands. However, their presence was not common or widespread.

24 Summary Northern tip of the distribution of P. cinnamomi and the pathogen may have not be able to survive the freezing conditions. Since these were reclaimed lands, fresh top soil layer would have been added and pathogen may not have had time to relocate to these soils. It is not known how conducive the harsh soil conditions (low nutrients, pH extremes, toxic metals) are for the establishment of the pathogen. If this pathogen cannot survive in the mined lands, they would make highly suitable locations for the American chestnut restoration (Barton, et al, 2010).

25 Future Studies: Continue to evaluate hybrid seedlings for resistance to P. cinnamomi. Identify backcrossed lines with high levels of resistance Difficulty is that resistance appears to be incompletely dominant and regulated by more than one gene (Jeffers et al. 2010). Pre-screening for soils that do not harbor P. cinnamomi. Proper site selection of areas that have proper drainage Continue experimental plantings that identify methods that improve establishment and long-term survival of chestnut.

26 Questions?


Download ppt "Shiv Hiremath, Kirsten Lehtoma, and Jenise M. Bauman"

Similar presentations


Ads by Google