1. Control of Gene Expression
MB207. Molecular Cell Biology
Control of Gene Expression
General Principles
Transcriptional controls
Gene regulatory proteins
Genetic Switches
Post-transcriptional control

2. General Principles
All cells of a given organism share the same genome, they are different from one another because they make and accumulate different sets of RNAs and proteins.
e.g. neuron vs RBC
Some proteins are abundant in specialized cells and can not be detected in any other type of cells, e.g. hemoglobin.
Normally one cell only express a fraction of its genes.
A set of proteins are common in all cells encoded by "housekeeping genes" such as histones, ribosomal proteins, DNA polymerase etc.
The complement of proteins expressed in a given cell can change in response to external (or internal, programmed) signals.
e.g. starvation will signal liver to produce glucose from tyrosine, expression of tyrosine amino transferase will be increased.
Path: DNA  mRNA  protein, gene expression can be regulated at any point.

3. Control of Gene Expression5 3 6 1 2 4
Transcriptional control: controls when & how often a gene is transcribed
Post-transcriptional control:
2) RNA processing control: determines how RNA is processed
3) RNA transport and localization control: selection of mRNA to be transported to cytosol
4) mRNA degradation control: selection of which mRNA to be destabilized
5) Translational control: selection of which mRNA to be translated
6) Protein activity control / post-translational control: regulation of proteins by activation, deactivation, degradation, compartmentalization & modification of proteins

4. How do cell decide which genes to be transcribed?
Transcription is not determined by RNA polymerase in eukaryotes but by transcription factors.
- In order for genes to be transcribed, general transcription factors have to be assemble with RNA polymerase at core promoter.
- To improve the efficiency of transcription, other transcription factors are required (located upstream or sometimes downstream).
Regulatory transcription factors
- transcription factors selectively bind to sequences located outside the core promoter.
- increase or decrease transcription initiation by interacting with components of the transcription machinery.
- recognize and bin to specific DNA sequences found in proximal control elements, enhancers and silencers.
Regulatory transcription factors possess two distinct activities:
- ability to bind to a specific DNA sequence (DNA-binding domain).
- ability to regulate transcription (activation domain).

5. How the different bps in DNA can be recognized from their
edges without the need to open
the double helix??
DNA recognition code

6. Gene regulatory proteins –any protein that interacts with DNA sequences of a gene and controls its transcription
Gene regulatory proteins contain a special surface features that complement extensively to the specific structure of the DNA double helix
Protein-DNA interaction are strong and consist of contacts, involving various amino acids.
Name
DNA sequence recognized
Bacteria
Lac repressor
5’ AATTGTGAGCGGATAACAATT 3’
3’ TTAACACTCGCCTATTGTTAA 5’
Mammals
Sp1
(TF)
5’ GGGCGG 3’
3’ CCCGCC 5’
Tumor suppressor protein
p53
5’ GGGCAAGTCT 3’
3’ CCCGTTCAGA 5’
Any protein that interacts with DNA sequences of a gene and controls its transcription.

7. Common structural motifs in DNA-binding transcription factors:
Helix-turn-helix (HTH)- commonly found in prokaryotic proteins that regulate gene expression (at the level of transcription of DNA to RNA). For example E. coli lac repressor.
Zinc Fingers- common eukaryotic transcriptional regulators.
Leucine zipper- eukaryotic transcription factors
Helix-loop-helix (HLH)- similar to leucine zipper
HTH contain only aa
Homeodomain proteins – impt proteins that control critical developmental decision found in drosophila

8. Helix-turn-helix (HTH)
- One of the first recognized.
Consist of two  helices connected at a fixed angle by a short stretch of polypeptide chain (the “turn”).
recognition helix recognize and bind to specific DNA sequences by forming hydrogen bonds with bases located in the major groove.
Second helix stabilizes the overall configuration through hydrophobic interactions with the recognition helix.
HTH contain only aa
Homeodomain proteins – impt proteins that control critical developmental decision found in drosophila

9. Zinc Fingers
Consists of an α helix and β-sheet, held in place by a zinc ion.
Two types:
protein that activates transcription: an -helix and a -sheet held together by the zinc.
intracellular receptor proteins: two -helices are packed together .
Both use zinc as a structural component.
Both use an -helix to recognize major groove of the DNA.

10. Leucine zipper
Formed by interaction between two polypeptide chains, each containing an α helix with regularly spaced leucine residues.
The helices are held together by hydrophobic interactions between hydrophobic amino acids, mostly mediated by Leu residues.

11. Helix-loop-helix
consist of a short α helix connected by a loop to another longer α helix.
The short helices mediate protein dimerization while the long ones bind the DNA.

12. How genetic switches work?
"Simple" control mechanisms in prokaryotes
Overall objective in prokaryotes is maximal growth rate in favorable environment
To economize, many genes are only transcribed when the gene product is needed but are turned off when the product is not needed
Two general categories of regulation
Negative control: repressor protein present which prevents transcription, inducer (usually a small molecule) is needed to allow initiation of transcription.
Positive control: activator protein induces transcription. No repressor must be overridden.
These two are not mutually exclusive, some genes are regulated via both kinds.

13. Gene regulatory proteins control gene transcription in prokaryotes

14. How genetic switches work?
In eukaryotes transcriptional control is more complex but the same basic principles apply.
Eukaryotes gene regulatory proteins can control transcription when bound to DNA far away from the promoter
Cis-acting regulatory sequences: present on the same chromosome and usually adjacent to the actual gene
Trans-acting regulatory sequences: present far from the actual gene being regulated - even on a separate chromosome
Gene regulatory proteins can influence the rate of transcription initiation
Activators increase it while repressors decrease it
Transcriptional regulation can be via various mechanisms

15. The gene control region of an eukaryotic gene

17. Transcription Initiation Machinery
Promoters have a sequence 25 to 35 bps upstream of the transcription start site (TATA box)
At least 5 basal transcription factors needed for initiation:
TFIID binds the TATA box. It is made of TBP (TATA box-binding protein) and other proteins known as TAFis (TBP-associated factors).
TBP then binds TFIIB. The TBP-TFIIB complex serves as bridge to the RNA pol II via TFIIF.
Transcription is finally initiated after binding of TFIIE and TFIIH to the complex. TFIIH has two important activities: as helicase, unwinds DNA at initiation site, and as kinase, phosphorylates RNA pol II to release it from the initiation complex and shift it to elongation mode.
Enhancers: Activator
DNA-looping allows a transcription factor bound at distant enhancer to interact with RNA pol or other transcription factors.
Mediators – Allow proper communication between the activators and the DNA as well as the general transcription factors
Chromatin-modifying enzymes – Chromatin remodeling factors, facilitate the binding of transcription factors by disruption chromatin structure. Histone acetylation facilitate transcription by stabilizing decondensed forms of chromatin.
RNA polymerase required the help of a lot of proteins before the transcription can actually started
General transcription factors – to recognize the promoter and to make specific contact between the Polymerase and the DNA
Transcriptional activators – to overcome the difficulty of Polymerase and general transcription factors binding to the DNA that was tightly packaged in chromatin
Mediators – Allow proper communication between the activators and the DNA as well as the general transcription factors
Chromatin-modifying enzymes – Allow accessibility of the whole assemble of transcription initiation machinery to the DNA

18. Transcription Initiation Machinery

20. Order of events leading to transcription initiation at a specific promoter

21. Three ways in which eukaryotic gene repressor proteins can operate
Competitive DNA binding
- Gene activator and gene repressor proteins compete for binding to the same regulatory DNA sequence.
Masking the activation surface
- Both proteins can bind DNA but the repressor binds to the activation domain of the activator protein thereby preventing it from carrying activation functions.
C) Direct interaction with the general transcription factors -the repressor interacts with an early stage of the assembling complex of general transcription factors, blocking further assembly.
Suppress transcription

22. Combinatorial model for gene expression
proposes that a relatively small number of different DNA control elements and transcription factors acting in different combinations, can establish highly specific and precisely controlled patterns of gene expression in different cell types.
a gene is expressed at a maximum level only when the set of transcription factors produced by a given cell includes all the regulatory transcription factors that bind to that gene’s positive DNA control elements.

23. DNA methylation - responsible for imprinting and suppressing certain genes
- is the addition of methyl groups to selected cytosine bases in DNA.
- tend to cluster where promoter sequences are located.
- associated with inactive regions of the genome.
Methylation of promoter regions:
- block access of proteins required for transcriptional activation.
- serve as a binding site for proteins that condense chromatin into inactive configurations.
→ localized or regional silencing of gene expression.
DNA methylation enzyme (maintenance methyltransferase) acts preferentially on cytosines located in 5’-CG-3’ sequences that are base paired to complementary 3’-GC-5’ sequences that already methylated.
→ DNA methylation can be inherited during successive rounds of DNA replication.
Methylated form of cytosine is 5-methylcytosine.
DNA of inactive genes are heavily methylated that then DNA of active genes.
Genomic imprinting
- causes certain genes to be expressed differently depending on whether they are inherited from maternal or paternal.

25. Possible Post-transcriptional controls on gene expression
Alternate Splicing
RNA Editing
RNA Degradation

26. Alternative splicing 4 patterns of alternative RNA splicing
Alternative RNA splicing – in which a cell can splice the primary transcript in different ways to make different polypeptide chains from the same gene.
Constitutive alternate splicing is a result of the "leakiness" of the splicing mechanism due to intron sequence ambiguity. Spliceosome is unable to distinguish cleanly between two or more alternative pairings of 5’ and 3’ splice sites which resulted several versions of the protein encoded by the gene are made in all cells in which the gene is expressed.
Regulated alternative splicing involves additional proteins that control the way the splicing machinery works. Can be regulated either negatively (by a repressor protein) or positively by an activator.
Exons

27. Constitutive alternative splicing SV40 T antigen RNA
Five ways to splice an RNA
Alternative splicing of SV40 T-antigen
Constitutive alternative splicing SV40 T antigen RNA

28. Alternative splicing - Regulated alternative splicing
Repressor protein binds
RNA prevent splice
machinery from
removing intron seq
Splice machinery unable to
efficiently remove intron seq
without help from activator
protein

29. Alternative splicing Regulation of the site of RNA cleavage and
poly A addition – whether
an antibody molecule is
secreted or remains
membrane-bound.

30. RNA editing – is another way of altering the sequence of an mRNA
The sequence of an RNA is changed after being transcribed.
→ individual bases are either inserted, deleted or changed.
Two mechanisms:
i) site-specific deamination of adenines or cytosines
ii) guide RNA-directed uridine insertion or deletion
Deamination of cytosine and adenine produce uracil and inosine respectively.

31. RNA editing by deamination
Mammalian apolipoprotein-B gene has several exons.
A particular CAA codon is targeted for editing in which the cytosine gets deaminated and is converted to uracil in intestinal cells.
CAA codon is converted to UAA (stop signal) resulted a truncatd polypeptide is being produced in the intestine.

32. RNA editing by guide RNA mediated U insertion – Editing of the trypanosome coxll gene
Shows the positions of the 4 U nts inserted into the pre-mRNA.
Shows the sequence of the guide RNA that determines the U insertion pattern and the sequence of the unedited stretch of mRNA.
Shows the editing reaction itself.

33. RNA degradation
Gene expression can be controlled by a change in mRNA stability.
→ if an mRNA molecule is degraded rapidly, less time is available for it to be translated.
Half-lives of eukaryotic mRNAs vary from 30min or less to 10hr.
mRNA stability is influenced by
- length of polyA tail.
→ mRNA with short polyA tails tend to be less stable than mRNA with longer polyA tails.
- AU-rich sequence in 3’UTR
→ AU-rich sequence triggers removal of polyA tail by degradative enzymes.
Two mechanisms for degrading mRNAs
the poly-A tails (which average about 200 As in length) are gradually shortened by an exonuclease that chews away the tail in the 3’ to 5’ direction. Once a critical threshold of tail shortening has been reached (approximately 30 A's remaining), the 5’ cap is removed (a process called "decapping"), and the RNA is rapidly degraded.
mRNA degradation begins with the action of specific endonucleases, which simply cleave the poly-A tail from the rest of the mRNA in one step.

34. RNA degradation Deadenylation dependent decay
(common pathway)
Deadenylation independent
decay