1. Plastids Plastids (derived from proplastids) 1.Chromoplast 2.Chloroplast 3.Amyloplast 4.Leucoplast 5.Elaioplast 6.Etioplast In plants, meristamatic cells contain 10-14 proplastids, each carrying 1- 2 nucleoids per proplastid, whereas leaf cells may contain 100 chloroplasts, with 10-14 nucleoids each. There are several ptDNA per nucleoid. Thus proplastids contain lower copies of ptDNA than chloroplasts. Plastid nucleoid ptDNA copies

2. The Structure of of O. sativa Chloroplast Genome ~120 genes ~50 transcription units Two inverted repeats One large single copy region One small single copy region These are salient features of any higher plant plastids

3. Conserved Features of Chloroplast Genomes in Higher Plants LSCIR B SSCIR A 86,68625,34118,57125,341 82,35522,748 12,536 80,59220,799 12,334 81,095 10,058 19,813 65,696495 53,021 19,79922,735 4759 Tobacco (155,939 bp) Maize (140,387 bp) Rice (134,525 bp) Marchantia (121,024 bp) Black pine (119,707 bp) Epifagus (70,028) LSC= Large single copy regionSSC= small single copy region

4. Genes Encoded in the Chloroplast Genomes in Higher Plants Gene Designation Gene Product I. Genetic System Chloroplast RNA genes rDNA Ribosomal RNAs (16S, 23S, 4.5S, 5S) trnTransfer RNAs (30 species) Gene transcription rpoA, B, CRNA polymerase , ,  ’ subunits ssbssDNA-binding protein Protein synthesis rps2,3,4,7,8,1130S ribosomal proteins (CS) 2, 3, 4, 7, 8, 11 rps12, 14, 15, 16, 18, 19CS12, 14, 16, 18, 19 rpl2, 14, 16, 20, 2250S ribosomal proteins (CL) 2, 14, 16, 20, 22 infAInitiation factor I II. Photosynthesis Photosynthetic proteins rbcLRUBISCO large subunit atpA, B, EATP synthetase CF1 , ,  subunits atpF, H, IATP synthetase CF 0 I, III, IV subunits psaA, B, CPhotosystem I A1, A2, 9-kDa protein psbA, B, C, D, EPhotosystem II D1, 51 kDa, 44 kDa, D2, Cytb559-9kDa psbF, G, H, IPhotosystem II Cytb559-4kDa, G, 10Pi, I proteins petA, B, DElectron transport Cytf, Cytb6, IV subunits Respiratory proteins ndhA, B, C, DNADH dehydrogenase (ND) subunits 1, 2, 3, 4 ndhE, FNDL4L, 5 III. Others MaturasematK ProteaseclpP Envelope membrane proteincemA

5. Organization of chloroplast genes into operons psbBpsbTpsbHpetB Intron petD psbN Polycistronic mRNA Monocistronic mRNA

6. The Endosymbiont Theory Common ancestor of plastid and modern cyanobacteria Common ancestor of mitochondira and  -group of modern proteobacteria Protoeukaryotic cell Photosynthetic eukaryotic cell Flowering plant Photosynthetic C-reduction Respiration

7. The Endosymbiont Theory Supporting Evidences 1. Molecular architecture and genome replication a) Plastid genomes are naked covalently closed circular DNA molecules (devoid of histones). b) Replication of plastid DNA is independent of the nuclear genome replication c) Promoters of most chloroplast genes contain DNA sequences similar to the E. coli ‘- 10’ and ‘-35’ promoter motifs. d) Chloroplast open reading frames are polycistronic. e) Plastid genomes contain few moderately or highly repetitive sequences f) Chloroplast genomes of Euglena, Chlamydomonas and most angiosperms carry 2 or 3 rRNA genes which are similar in size to their prokaryotic homologs (23S, 16S, 5S)

8. Chloroplast promoters psbA TTGGTTGACATGGCTATATAAGTCATGTTATACTGTTCAAT psbA TTGGTTGACACGGGCATATAAGGCATGTTATACTGTTGAAT rbcL TGGGTTGCGCCATATATATGAAAGAGTATACAATAATGATG atpB TCTTGACAGTGGTATATGTTGTATATGTATATCCTAGATGT trnM TTATATTGCTTATATATAATATTTGATTTATAATCAATCTA Mustard Spinach “-35”“-10”

9. 1) Chloroplast promoters- similar to bacterial minimal promoter. psbA TTGGTTGACATGGCTATATAAGTCATGTTATACTGTTCAAT psbA TTGGTTGACACGGGCATATAAGGCATGTTATACTGTTGAAT rbcL TGGGTTGCGCCATATATATGAAAGAGTATACAATAATGATG atpB TCTTGACAGTGGTATATGTTGTATATGTATATCCTAGATGT trnM TTATATTGCTTATATATAATATTTGATTTATAATCAATCTA Mustard Spinach “-35”“-10” Features of chloroplast transcription 2) Polycistronic. 3) Cis-elements located in the 5’-UTR. 4) Nuclear-encoded transcription factors.

10. Features of chloroplast translation (similar to prokaryotic translation) 1) Makes use of 70S ribosomes. 2) Uses fMet-initiator tRNA for the translation initiation codon. 3) The mRNAs are not capped. 4) The mRNAs are not poly-adenylated. 5) Ribosome binding occur in Shine-Delgarno-like sequence motif in the 5’-UT of mRNA. 6) Not coupled to transcription and trnaslational units can occur as stable ribonucleoprotein complexes.

11. The Endosymbiont Theory (cont.) Supporting Evidences 2) Transcription a) RNA polymerases from cyanobacteria (e.g. Chlamydomonas) and higher plants (e.g. maize) are more similar to the eubacterial than to the nuclear homologs. b) Genes encoding for proteins of related functions are organized into operons and thus are co-transcribed. c) The limiting regulatory step of gene expression is at post-transcriptional and translational level. d) Transcription terminators are more similar to bacterial sequences. d) A minor fraction of chloroplast mRNAs are polyadenylated.

12. The Endosymbiont Theory (cont.) Supporting Evidences 3) Translation a) Plastid ribosomes are more similar to prokaryotic ribosomes than to their cytoplasmic counterparts: cytoplasmic ribosomes- 80S (40S + 60S subunits) Plastid and prokaryotic ribosomes- 70S (30S + 50S subunits) Antibodies raised against 70S and 30S subunits of plastid ribosomes are active against E. coli b) Plastid ribosomal RNA gene sequences are more similar to modern cyanobacteria (e.g. Synechococcus lividus) than to their nuclear counterparts.

13. The Endosymbiont Theory (cont.) Supporting Evidences 4) Others (biflagellate protists) The case of Cyanophora paradoxa (and other types of marine nudibrachs or sea slugs) Endosymbiotic Cyanobacterium Photosynthetic Cyanelle Cyanophora paradoxa

14. Plastid transformation Basic Requirements: 1)Method of delivery (Biolistic method) 2)Selectable marker (dominant marker) Firing pin Helium gas Nylon macro-projectile Micro-projectile DNA-coated gold particles Vents Plate to stop nylon projectile Target cells or tissues 3”-adenylyltransferase (aadA) Spectinomycin inhibits protein biosynthesis (70S ribosomes) Spectinomycin Adenylylspectinomycin (inactive protein synthesis inhibitor) AMP Construct: “-35” “-10” 5’-UTR SD aadA-ORF 3’-UTR First successful plastid transformation was reported in 1988 for chlamydomonas. Then in 1990 for tobacco. Since then only tomato has been added to the list of reproducible systems, though reports exist for cotton, wheat etc.

15. A transformed plastid genome is formed by two recombination events that are targeted by homologous sequences. The plastid genome segments that are included in the vector are marked as the left (LTR) and right targeting regions (RTR).

16. Chloroplast Genetic Engineering Prokaryotic – No need for codon optimization 10, 000 copies per cell – high expression Maternal inheritance Not expressed in fruits ? Multigene engineering Homologous recombination

17. Advantages of Chloroplast Transformation GeneContainment MaternalInheritance No Gene Silencing No Position Effect Hyper-expression MultigeneEngineering No Vector SequencesNoPleiotropicEffects

18. Cry2Aa2 Single Gene Expression 0 0.05 0.1 0.15 0.2 0.25 0.3 0.35 0.4 Control young mature old Transgenic Leaf Age % Total Soluble Protein Cry2Aa2 Operon Expression 0 10 20 30 40 50 Control young mature old Transgenic Leaf Age % Total Soluble Protein A. B. 100 fold higher expression obtained by plastid transformation (B) compared to nuclear transformation (A)

19. Accelerated gold particle coated with transforming DNA ~10,000 plastid genomes/cell Primary plastid transformation event (change of single plastid DNA molecule) Cell and organelle divisions under antibiotic selection (heteroplasmy) Several cycles of antibiotic selection (homoplasmy) Heteroplasmy vs homoplasmy nucleus chloroplastproplastid sorting biogenesis

20. Selection of transplastomic clones by spectinomycin resistance. (A) Spectinomycin inhibits callus formation, greening, and shoot regeneration from tobacco leaf segments on shoot regeneration medium. Transplastomic clones are resistant to spectinomycin and are identified as green shoots or calli. (B) The shoots are chimeric, visualized by accumulation of green fluorescent protein in transplastomic sectors. Spectinomycin resistance is not cell autonomous as sensitive sectors are also green. (C) Spontaneous spectinomycin resistant mutants are sensitive (top), transplastomic clones are resistant to streptomycin (bottom) when cultured on a selective streptomycin (500 mg/L) medium.

21. Comparison of the nuclear and plastid genomes of angiosperms Nuclear genomePlastid genome ChromosomesTwo copies of each of ~60 copies of a single circular many chromosomes; chromosome per plastid the number of ~50–60 chloroplasts per cell chromosomes per diploid cell is species -specific Genes per chromosomeCould be thousands ~120–150 Arrangement and Each gene is separate Many genes are in operons transcription of genes (individually transcribed )(transcribed together)

22. Currently known primary markers are resistance to spectinomycin, streptomycin, and kanamycin, which inhibit protein synthesis on prokaryotic-type plastid ribosomes. These antibiotics inhibit greening, cell division, and shoot formation in tobacco culture. Therefore, greening, faster proliferation, and shoot formation were used to identify transplastomic clones on a selective medium. The first transplastomic clones were obtained by spectinomycin selection. Because spectinomycin allows slow proliferation of nontransformed tobacco cells it was assumed that the choice of a drug that enables such "nonlethal" selection is important to recover transplastomic clones. However, transplastomic clones were soon identified by kanamycin selection using an antibiotic concentration that is considered "lethal" (50 mg/L). Thus, slow proliferation of nontransformed cells on a selective medium is not an essential feature of the selection scheme. Initial transformation vectors carried a plastid 16S rRNA (rrn16) gene with point mutations that prevent binding of spectinomycin or streptomycin to the 16S rRNA. The rrn16 target site mutations are recessive, and were 100-fold less efficient than the currently used dominant aadA gene. Streptomycin resistance encoded in the rps12 ribosomal protein gene was also included in an early vector. The neo (aph(3')IIa) gene encodes neomycin phosphotransferase II [NPTII; APH(3')-II], and was used to select transplastomic clones in tobacco. The aphA-6 gene encodes aminoglycoside phosphotransferase or APH(3')-VI, and was used to select transplastomic clones by kanamycin and amikamycin resistance in Chlamydomonas and by kanamycin resistance in tobacco. Direct selection for spectinomycin resistance and for highly expressed kanamycin resistance genes, on average, yield one transplastomic line in a bombarded leaf sample. Selection markers

23. Most of the lecture material is derived from: 1.Pal Maliga (2004) PLASTID TRANSFORMATION IN HIGHER PLANTS. Annual Review of Plant Biology. 55: 289-313. 2.Pal Maliga (2002) Engineering the plastid genome of higher plants. Current Opinion in Plant Biology 2002, 5:164–172