Presentation is loading. Please wait.

Presentation is loading. Please wait.

Biotechnology Using Biology to Solve Societys Problems.

Similar presentations


Presentation on theme: "Biotechnology Using Biology to Solve Societys Problems."— Presentation transcript:

1 Biotechnology Using Biology to Solve Societys Problems

2 13.1 What Is Biotechnology? Genetic engineering – modify DNA to produce ______ (?) Genetic engineering – modify DNA to produce ______ (?) Recombinant DNA – genetically modified organisms; recombinant Recombinant DNA – genetically modified organisms; recombinant Agriculture Agriculture Medicines Medicines Forensics Forensics Resistant to fungus

3 13.2 Natural Recombination Recombination of genes happens naturally in sexually reproducing organisms Recombination of genes happens naturally in sexually reproducing organisms Meiosis and fertilization Meiosis and fertilization Recombination of genes Recombination of genes Law of Segregation Law of Segregation Law of Independent Assortment Law of Independent Assortment Random chance Random chance Crossing over Crossing over

4 Bacterial Recombination Bacteria – binary fission (asexual, cloning) Bacteria – binary fission (asexual, cloning) No genetic variation No genetic variation Genetic recombination by 3 means: Genetic recombination by 3 means: Mutation – goof in the code Mutation – goof in the code Transformation – pick up DNA from environment Transformation – pick up DNA from environment Transduction – viruses transfer DNA Transduction – viruses transfer DNA Conjugation – bacteria swap DNA Conjugation – bacteria swap DNA

5 Transformation Bacteria can absorb DNA from the environment Bacteria can absorb DNA from the environment Enables some bacteria to become resistant to antibiotics (MRSA) Enables some bacteria to become resistant to antibiotics (MRSA) Griffiths experiment Griffiths experiment Non-pathogen became pathogen Non-pathogen became pathogen

6 plasmid bacterial chromosome DNA fragments bacterial chromosome Transformation with DNA fragment Bacterium bacterial chromosome Transformation with plasmid plasmid Transformation

7 Conjugation Transfer of genes by bacteria that are temporarily joined Transfer of genes by bacteria that are temporarily joined E. coli E. coli Pili - appendage on the surface of a bacterium through which cytoplasm can move Pili - appendage on the surface of a bacterium through which cytoplasm can move

8 Plasmids Circular DNA in bacteria that carries extra genes Circular DNA in bacteria that carries extra genes F = fertility; the ability to grow sex pili F = fertility; the ability to grow sex pili R = various resistance factor(s) R = various resistance factor(s)

9 Transduction Transfer of genes from one bacterium to another by phages Transfer of genes from one bacterium to another by phages Hershey-Chase; used T4 phage to determine that DNA was the molecule of heredity Hershey-Chase; used T4 phage to determine that DNA was the molecule of heredity

10

11 Restriction Enzymes Bacteria have enzymes that cut DNA in specific locations Bacteria have enzymes that cut DNA in specific locations Cut out phages Cut out phages Enzymes have recognition sites Enzymes have recognition sites Specific sequence of nucleotides Specific sequence of nucleotides Palindromes Palindromes Race car; anna; madam; flee to me remote elf; gnu dung; lager sir is regal; tuna nut Race car; anna; madam; flee to me remote elf; gnu dung; lager sir is regal; tuna nut Restriction enzymes

12 Biotechnology ForensicsAgriculturalMedical

13 Forensics – DNA Fingerprinting Restriction enzymes cut pieces of DNA in very specific locations Restriction enzymes cut pieces of DNA in very specific locations Create pieces of DNA of differing lengths Create pieces of DNA of differing lengths Restriction Fragment Length Polymorphisms, FFLPs Restriction Fragment Length Polymorphisms, FFLPs

14 Other restriction enzymes

15 Forensics RFLPs

16 Forensics Large and small pieces can be separated Large and small pieces can be separated Gel electrophoresis – process used to separate RFLPs Gel electrophoresis – process used to separate RFLPs 1. Cut DNA with restriction enzymes 2. DNA loaded into a gel bed with wells 3. Electricity pulls the negative DNA towards the positive pole through the gel bed 4. Large pieces move slower creating separation Gel electrophoresis

17 DNA samples are pipetted into wells (shallow slots) in the gel. Electrical current is sent through the gel (negative at end with wells, positive at opposite end.) gel power supply wells pipetter

18 Electrical current moves DNA segments through the gel. Smaller pieces of DNA move farther toward the positive electrode. DNA bands (not yet visible) Gel electrophoresis

19 Southern Blotting Technique Too many bands are created during electrophoresis Too many bands are created during electrophoresis Have to make specific bands visible Have to make specific bands visible Nitrocellulose paper is placed on the gel Nitrocellulose paper is placed on the gel Alkaline solution unwinds the DNA helix Alkaline solution unwinds the DNA helix Separated strands of DNA are absorbed by the nitrocellulose paper (blotting) Separated strands of DNA are absorbed by the nitrocellulose paper (blotting) PCR

20 Gel is placed on special nylon paper. Electrical current drives separated DNA out of gel onto nylon. gel nylon paper

21 Southern Blotting Radioactive or colored probes are mixed with the blot Radioactive or colored probes are mixed with the blot Probes pair with their complimentary STR Probes pair with their complimentary STR Probes can be seen Probes can be seen

22 Nylon paper with DNA is bathed in a solution of labeled DNA probes (red) that are complementary to specific DNA segments in the original DNA sample. nylon paper solution of DNA probes (red)

23 STR #1: probe base-pairs and binds probe label (colored molecule)

24 STR #2: probe cannot base-pair; does not bind

25 Complementary DNA segments are labeled by probes (red bands).

26

27 DNA Forensics STR – short, tandem repeats of nucleotides (4 or 5) STR – short, tandem repeats of nucleotides (4 or 5) AGATAGATAGATAGATAGAT AGATAGATAGATAGATAGAT Common in non-coding regions of DNA (introns) Common in non-coding regions of DNA (introns) Number of times it repeats is variable Number of times it repeats is variable DNA fingerprint - use multiple STRs (10-13) to determine identity DNA fingerprint - use multiple STRs (10-13) to determine identity

28 A T G C A T T A A T G C A T T A A T G C A T T A T A A T A T T A T A T A T A G C A T A T G C A T T A 8 side-by-side (tandem) repeats of the same 4-nucleotide sequence, A T G C A T T A A T G C A T T A A T G C A T T A A T G C A T T A A T G C A T T A A T G C G C T A A T

29 STR name Penta D CSF D16 D16: an STR on chromosome 16 DNA samples from 13 different people D7 D13 D5 15 14 13 12 11 10 9 8 Number of repeats Variety of STRs used to isolate one individual DNA fingerprint

30 Forensics Polymerase Chain Reaction - amplifies DNA Polymerase Chain Reaction - amplifies DNA PCR copies a specific DNA sequence PCR copies a specific DNA sequence Need to make more copies of the DNA Need to make more copies of the DNA DNA is degraded (old) DNA is degraded (old) Not a large enough sample Not a large enough sample

31 Each PCR cycle doubles the number of copies of the DNA 123 PCR cycles 4 etc. 12 4 8 DNA copies 16 etc. DNA fragment to be amplified One PCR cycle original DNA 90 °C50 °C72 °C 1 Heating separates DNA strands. 2 Cooling allows primers and DNA polymerase to bind. 3 New DNA strands are synthesized. primers DNA polymerase new DNA strands Primers – RNA sequences that tell DNA polymerase where to start copying Primers + free nucleotides + DNA polymerase + heat = copies of DNA Copies can be used for forensics, cloning, recombinations

32 Transgenic Organisms Using biotechnology to rearrange genomes Using biotechnology to rearrange genomes Medical Medical Agricultural Agricultural Bioethics Bioethics

33

34 Cut both with the same restriction enzyme. Mix Bt gene and plasmid; add DNA ligase to seal DNA. Transform Agrobacterium tumifaciens with recombinant plasmid Infect plant cell with transgenic bacterium. Insert Bt gene into plant chromosome. DNA including Bt geneTi Plasmid Bt gene plant cell plant chromosomes A. tumifaciens plasmids bacterial chromosome Cloning a gene

35 Agricultural Use Knowing genome of and organism enables us to interfere with normal protein production Knowing genome of and organism enables us to interfere with normal protein production Insert, remove genes Insert, remove genes Sterile Insect Technique Sterile Insect Technique Irradiate then release Irradiate then release Insert lethal gene – then release Insert lethal gene – then release Silk worm – industrial strength, glow-in-the-dark silk Silk worm – industrial strength, glow-in-the-dark silk

36 Transgenic Organisms Transgenic mosquitoes Transgenic mosquitoes Anopheles sp. carry malaria parasite Anopheles sp. carry malaria parasite Insert genes so that they cannot Insert genes so that they cannot

37 The introduction of genes that impair Plasmodium (Malaria parasite) development into mosquito populations is a strategy being considered for malaria control. The effect of the transgene on mosquito fitness is a crucial parameter influencing the success of this approach. We have previously shown that anopheline mosquitoes expressing the SM1 peptide in the midgut lumen (intestine) are impaired for transmission of Plasmodium berghei. Moreover, the transgenic mosquitoes had no noticeable fitness load compared with nontransgenic mosquitoes when fed on noninfected mice. Here we show that when fed on mice infected with P. berghei, these transgenic mosquitoes are more fit (higher fecundity and lower mortality) than sibling nontransgenic mosquitoes. In cage experiments, transgenic mosquitoes gradually replaced nontransgenics when mosquitoes were maintained on mice infected with gametocyte-producing parasites (strain ANKA 2.34) but not when maintained on mice infected with gametocyte-deficient parasites (strain ANKA 2.33). These findings suggest that when feeding on Plasmodium-infected blood, transgenic malaria-resistant mosquitoes have a selective advantage over nontransgenic mosquitoes. This fitness advantage has important implications for devising malaria control strategies by means of genetic modification of mosquitoes. Transgenic malaria-resistant mosquitoes have a fitness advantage when feeding on Plasmodium-infected blood Mauro T. Marrelli, Chaoyang Li, Jason Rasgon, Marcelo Jacobs-Lorena

38 Dolly and her ewe

39

40 Transgenic Organisms Restriction enzymes cut bacterial plasmid DNA (pDNA) Restriction enzymes cut bacterial plasmid DNA (pDNA) Same restriction enzymes cut genes of interest from another organism Same restriction enzymes cut genes of interest from another organism Genes of interest added to a solution with pDNA Genes of interest added to a solution with pDNA DNA ligase (glue) is added to glue pieces together DNA ligase (glue) is added to glue pieces together

41 Biotechnology In Agriculture Many Crops Are Genetically Modified Many Crops Are Genetically Modified Tomatoes – slow ripening process Tomatoes – slow ripening process Tomatoes – insect resistance Tomatoes – insect resistance Bacillus thuringiensis – produces a natural insecticide Bacillus thuringiensis – produces a natural insecticide Desired genes are cloned (insecticide gene) Desired genes are cloned (insecticide gene)

42 Biotechnology in Agriculture Transgenic plants are cloned in vitro Transgenic plants are cloned in vitro Plants are bred together creating 2 nd generation plant with insect-resistance gene Plants are bred together creating 2 nd generation plant with insect-resistance gene Plants produce antibodies to fight disease (?) Plants produce antibodies to fight disease (?)

43 Fish given growth hormones; GMT@

44

45 13.5 How Is Biotechnology Used for Medical Diagnosis and Treatment? DNA Technology Can Be Used to Diagnose Inherited Disorders DNA Technology Can Be Used to Diagnose Inherited Disorders Restriction Enzymes May Cut Different Alleles of a Gene at Different Locations Restriction Enzymes May Cut Different Alleles of a Gene at Different Locations Diagnosing sickle-cell anemia with restriction enzymes Diagnosing sickle-cell anemia with restriction enzymes Normal allele Sickle cell

46 normal globin allele Mst II cuts a normal globin allele in 2 places, but cuts the sickle-cell allele in 1 place. sickle-cell globin allele Mst II DNA probe Mst II DNA probe large small AAASSS Homozygous Heterozygote Homozygous sickle-cell

47 Medical Treatment DNA Technology Can Be Used to Treat Disease DNA Technology Can Be Used to Treat Disease Examples of Currently Used Products Produced by Recombinant DNA Methods Examples of Currently Used Products Produced by Recombinant DNA Methods

48 Medical Diagnosis and Treatment Treat Cystic Fibrosis Treat Cystic Fibrosis Cure Severe Combined Immune Deficiency Cure Severe Combined Immune Deficiency

49 parents with genetic disease fertilized egg with defective gene embryo with genetic defect therapeutic gene genetically corrected cell from culture egg cell without nucleus genetically corrected clone of original embryo healthy baby baby with genetic disorder genetically corrected egg cell treated culture viral vector

50 amniocentesis vagina placenta uterus fetus amniotic fluid chorionic villi chorionic villus sampling (by suction) cells: sex determination, biochemical and enzymatic studies cell culture: biochemical studies, chromosomal analysis, analysis using recombinant DNA methods centrifuge fluid: composition analysis

51 13.6 Ethical Issues of Biotechnology Should Genetically Modified Organisms Be Permitted in Agriculture? Should Genetically Modified Organisms Be Permitted in Agriculture? Are Foods from GMOs Dangerous to Eat? Are Foods from GMOs Dangerous to Eat? Are GMOs Hazardous to the Environment? Are GMOs Hazardous to the Environment? Should a Human Genome Be Changed by Biotechnology? Should a Human Genome Be Changed by Biotechnology? Genetic screeningGenetic counseling HGP – the code HGP - ethics HGP - disease


Download ppt "Biotechnology Using Biology to Solve Societys Problems."

Similar presentations


Ads by Google