1. Natural polymorphisms in the protease of HIV-1 isolates explain hypersusceptibility to protease inhibitors A.F. Santos, D.M. Tebit, M.S. Lalonde, A. Ratcliff, M.A. Soares, E.J. Arts Antiretroviral therapy is now a reality in developing countries, where several HIV-1 non-B subtypes predominate. However, there are scarce studies on drug susceptibility in such subtypes. Our objective here was evaluate the influence of protease polymorphisms in CRF02_AG on drug susceptibility and fitness. Poster Discussion

2. Hypersusceptibility is defined when an isolate presents a higher susceptibility (at least 2.5 or more, or Fold-Change < or equal to 0.4) than subtype B wild type (HxB2 or NL43). We obtained 149 HIV-1 isolates of treament-naive patients from the Stanford HIV drug resistance database, which had been phenotyped by Antivirogram ® assay (VIRCO, Belgium). * * * * * * p value ≤ 0.05 HS Proportion

3. Protease Inhibitor IC 50 [nM] (Fold-change drug resistance) in MT-4 Cells AmprenavirAtazanavirNelfinavirSaquinavirIndinavir BD6-1524 ± 2 (1.00) 3.8 ± 0.5 (1.00) 23 ± 3 (1.00) 3.2 ± 0.2 (1.00) 20 ± 5 (1.00) 17E16 ± 5 (0.68) 2.9 ± 0.6 (0.74) 16 ± 2 (0.72) 3.2 ± 0.2 (1.00) ___ 64M16 ± 2 (0.68) 3.0 ± 0.8 (0.77) 16 ± 2 (0.72) 3.0 ± 0.2 (0.96) 16 ± 3 (0.81) 70R 9 ± 1 (0.41) ___ 7 ± 1 (0.34) 17E/64M15 ± 1 (0.63) 2.2 ± 0.5 (0.58) 8 ± 1 (0.36) 1.8 ± 0.3 (0.54) ___ NL4-317 ± 3 (0.70) 4.2 ± 0.5 (1.10) 23 ± 18 (1.00) 3.8 ± 0.9 (1.15) 13 ± 3 (0.67) Natural Polymorphisms conferring Hypersusceptibility

4. Natural polymorphisms increase replicative capacity Oligonucleotide Ligation Assay (OLA) Ranking: 17E/64M > 17E > 64M > BD6-15 GTTACAGTAAAATTAGGGGGACAGCTGATAGAAGCCTTAT (BD6-15) GTTACAGTAAAATTAGGGGAACAGCTGATAGAAGCCTTAT (17E) C Tagged primer 17G Tagged universal primer Tagged primer 17E Tagged universal primer T Ligation reaction (140 cycles) Detection of competitors by double fluorescence

5.  Some subtypes showed higher HS proportion than subtype B – the subtype for which drugs were designed;  The dual polymorphism 17E/64M increased greatly viral susceptibility to atazanavir, nelfinavir and saquinavir, while 70R alone causes HS to amprenavir and indinavir. This is the first study to showing that natural polymorphisms in viral protease present an inportant role in drug susceptibility to PIs;  The HS polymorphisms increased the viral fitness, suggesting that its presence increased the enzymatic processing. Additional studies are underway to test this hypothesis. Conclusions