1. Protein Synthesis “the job of a gene” IB Biochemical Biology

2. I. Overview A.Explain DNA (anti-sense strand) “unzipped” mRNA tRNA Polypeptide TACATACCCACTTACATACCCACT AUGUAUGGGUGAAUGUAUGGGUGA UACAUACCCACUUACAUACCCACU TRANS- CRIPTION TRANSLA -TION CODON ANTI- CODON Met Tyr Gly STOP Peptide linkage

3. The Genetic Code

4. B. Practice DNA (anti-sense) mRNA tRNAPolypeptide CATAAAGAAACTCATAAAGAAACT

5. B. Practice DNA (anti-sense) mRNA tRNAPolypeptide CATAAAGAAACTCATAAAGAAACT GUAUUUCUUUGAGUAUUUCUUUGA CAUAAAGAAACUCAUAAAGAAACU VAL PHE LEU STOP

6. Definitions… CODON – triplet of bases on an mRNA strand 3.5.3 RNA polymerase – forms an mRNA strand complementary to the ANTI- SENSE strand of DNA (the strand acting as the template) 3.5.2

7. C. Degeneracy – there is more than one codon for many amino acids Ex: GGU & GGA both code for glycine D. Universality – all living organisms use the same “triplet codes” E. One Gene, One Polypeptide -One gene codes for one polypeptide chain -Ex: 2 genes code for Hb (one for the each of the two alpha- chains, and one for each of the two beta chains) There are, of course, many exceptions.

8. F. Compare DNA & RNA (3.5.1) –Do a chart Sugar, base, strand number.

9. II. Transcription... DNA makes mRNA (3.5.2) A. Transcription terms: in eukaryotes RNA Polymerase 1. Splits DNA into 2 strands 2. Rewinds DNA after transcription 3. Uses RNA nucleoside triphosphates to build mRNA R Base Hi-energy bonds NUCLEOSIDE TRI- PHOSPHATE NUCLEOTIDE & ENERGY (used to join nucleotides together to make mRNA)

10. Sense strand – has same base sequence as mRNA (except U for T) Anti-Sense strand – has same base sequence as tRNA (template strand) –Is the strand TRANSCRIBED into mRNA Promoter region – a base sequence causing RNA polymerase to bind & begin transcription (has TATA box) Terminator – a base sequence which stops transcription

11. GATGAAATGATGAAAT CTACTTTACTACTTTA sense strand anti-sense strand 5’ 3’ 5’ 3’ PRO- MOTER (TATA) TERMI- NATOR GATGAAATGATGAAAT CTACTTTACTACTTTA GAUGGAUG 5’ GATGAAATGATGAAAT CTACTTTACTACTTTA GAUGAAUGAUGAAU Pre-mRNA strand has been transcribed (builds in 3’ direction) (7.3.1, 7.3.2, 7.3.3)

12. B. RNA splicing (7.3.4, 7.1.5) pre-mRNA (RNA which was just transcribed) Intervening sequence (non-coding) Expressed mRNA – will be coded into amino acids RNA transcript is “cut” by spliceosomes to release the introns (regulatory function but not expressed into proteins), and the exons are spliced together... 5’ end capped with a GUANINE NUCLEOTIDE –Functions as an “ATTACH HERE!” sign for ribosomes 3’ end given a poly(A) tail… 100+ (A) nucleotides mature mRNA: Exon Intron Exon Intron Exon Exon Exon Exon G AAAAAA G

13. III. Translation (3.5.4, 7.4.2) A.Processed mRNA moves out of the nucleus to the ribosome B.Structure of the ribosome is 60% rRNA & 40% protein LARGE SUBUNIT two tRNA binding sites P A mRNA binding site SMALL SUBUNIT rRNA – ribosomal RNA, made in the nucleolus

14. C. tRNA activation (7.4.1) 1.tRNA structure a. base sequence ACC at 3’ terminal for amino acid attachment b. two other major loops c. triplet of bases (anti-codon) in loop of seven nucleotides

15. d. sections which become double stranded by base pairing e. each tRNA has a distinctive 3- dimensional shape f. There are tRNA activating enzymes that match up amino acids with tRNA

16. 2. tRNA Activating Enzymes (IN CYTOPLASM) “tRNA- activating” enzyme (one for each amino acid) Energy from ATP is used to join tRNA to the amino acid... Catalyzed by the enzyme. tRNA ATP  AMP + 2P + ENERGY amino acid ACCACC 3’ 5’ Anti-codon

17. D. The process of translation Many ribosomes move along the same mRNA translating at the same time. 1.Initiation: a) tRNA with anticodon complementary to the mRNA start codon (AUG- methionine) binds to the small subunit of the ribosome POLYSOMEPOLYSOME (7.4.3, 7.4.6)

18. b) Large subunit joins small subunit c) This initiator tRNA is in P-site d) Another tRNA with its amino acid arrives and binds in the A-site e) Energy is supplied by GTP (guanine triphosphate) to form a peptide bond between the two amino acids 2. Elongation a) amino acids are added one by one to the growing chain

19. b) tRNA in the A-site is translated to the P-site, taking the mRNA with it c) ribosome moves 5’  3’ on the mRNA (7.4.4) d) Large subunit moves first, followed by small subunit, chain is ELONGATING 3. Termination a) ribosome reaches a STOP CODE on the mRNA (ex: UGA) b) released polypeptide has started folding

20. c) tRNA detaches, ribosome subunits separate E. Types of Ribosomes Free... make proteins used in cytoplasm of the cell (ex: hemoglobin)

21. Bound to ER... make proteins secreted by the cell (ex: digestive enzymes like pepsin)

22. IV. Gene Mutation –Permanent change in DNA –Affects the protein synthesized A.Insertion – the addition of a base DNA: T A AT A A T C C mRNA: AA: DNA:T A AT T A A T C C mRNA: AA: RESULT: “total frame shift”  non-functional protein ex: NO MELANIN = ALBINO

23. B. Deletion – also gives “frame shift” C. Substitution – less severe -no frame shift -imperfect protein… ex: Sickle Cell G A G (glutamic acid) mutated G T G (valine)

24. V. Regulation of Gene Expression At any particular time, some genes are expressed and making proteins and some are not Each gene is regulated separately in eukaryotes (…and in groups called “operons” in prokaryotes)

25. ONE “OPERON”: a single promoter serves multiple genes; a “transcription unit” “Lac operon in E. coli” 1. Regulator gene – codes for repressor protein (this gene is constantly expressed at a low rate, ensuring a continuous supply of repressors) 2. Without lactose, the repressor is active (and bound to the operator)… RNA polymerase cannot move past the promoter Promoter (TATA)operatorGENE #1GENE #2Terminator Regulator gene

26. 3. The repressor is allosteric, and when lactose is present, it binds to the repressor and changes its shape (causing it to fall off of the operator) 4. RNA polymerase can now move past the promoter, and the protein is made (which break down lactose as an energy source for the bacteria) 5. When all of the lactose is broken down, there isn’t any left to fit the repressor’s allosteric site (so the repressor goes back to the operator)

28. Two types of operon control… (reminder: in bacteria only!) 1.INDUCIBLE – The repressor blocks transcription unless it is stimulated by the presence of a molecule –Ex: lac operon 2.REPRESSIBLE – The repressor allows transcription unless it is activated to bind to the operator –Ex: trp operon

29. In eukaryotic cells –Many ways to regulate gene expression 1. The organization of chromatin -DNA can be de-activated before transcription occurs (by histone acetylation- adding an acetyl group … –COCH 3, or by methylation - the adding of a methyl group… CH 3 ) 2. Transcription -If “transcription factors” are not present to find and bind to the TATA box, mRNA will never be produced

30. 3. Processing of mRNA -If the proper spliceosomes are not present, mRNA will never leave the nucleus 4. Translation (Silencing by RNA interference) -Translational regulation – unique types of RNA can bind to the mRNA, making it impossible for translation to occur 5. Modification of the protein at the endoplasmic reticulum or golgi -addition of carbohydrate chains to proteins… -if the protein is to be short-lived, ubiquitin is added (to mark it for degradation)

31. VI. The Molecular Biology of Cancer… Cancer arises from mutations in genes that regulate cell growth and division –Can be spontaneous, from chemical carcinogens, physical mutagens (like X-rays), or viruses –Can be from changes in genes that normally INHIBIT cell division (called “tumor suppressor genes”) –Can be from changes in genes that allow NORMAL cell growth & division (proto- oncogenes)

32. p53 The p53 gene is expressed when there has been damage to a cell’s DNA… gene p53 can make a TRANSCRIPTION protein which suppresses cell (tumor) growth…

33. REGULATION OF TRANSCRIPTION TUMOR SUPPRESSOR PROTEIN Made by p53 gene Acts on DNA to synthesize GROWTH-INHIBITING PROTEINS Works as a Transcriptional Factor

34. Role of p53: 1) slows cell cycles to allow repairs to occur, 2) turns on genes that do repairs, 3) initiates apoptosis (programmed cell death) if damage can’t be repaired What would happen if a mutation due to environmental factors knocks out the p53 gene? Excessive cell growth and cancer!