Presentation is loading. Please wait.

Presentation is loading. Please wait.

Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Similar presentations


Presentation on theme: "Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to."— Presentation transcript:

1 Transcription vs. Translation Making Proteins

2 fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to can be RNA Messenger RNA Ribosomal RNA Transfer RNA mRNACarry instructions rRNA Combine with proteins tRNA Bring amino acids to ribosome DNARibosomeRibosomes

3 Transcription RNA polymerase binds to DNA and separates the DNA strand. Then RNA polymerase then uses one strand of DNA as a template from which nucleotides are assembled into a strand of RNA

4 RNA DNA RNA polymerase Transcription Section 12-3 Adenine (DNA and RNA) Cystosine (DNA and RNA) Guanine(DNA and RNA) Thymine (DNA only) Uracil (RNA only)

5 How does RNA read DNA? What is a codon? –Three nucleotides How does the RNA know where to start? –DNA polymerase only binds to promoters Specific codon that signifies the beginning of a sequence (AUG or methionine) How does the RNA know when to stop? –Specific codons that signify the end of a protein chain (there are 3 of them)

6 Transcription Video Click HereHere

7 Transcription Activity The following is a DNA code. Translate them into RNA and then into a protein chain using page 303 in your textbook: DNA= TAC CGA TTA GCG ATG AGT AGA ACT RNA= AUG GCU AAU CGC UAC UCA UCU UGA Start Alanine Asparagine Arginine Tyrosine Serine Serine Stop

8 Transcription vs. Translation Making Proteins

9 fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to can be RNA Messenger RNA Ribosomal RNA Transfer RNA mRNACarry instructions rRNA Combine with proteins tRNA Bring amino acids to ribosome DNARibosomeRibosomes

10 Reviewing Transcription Making mRNA from Copying DNA How is it different from DNA Replication? DNA ReplicationTranscription Copies both strands making 2 new DNA molecules Copies one strand of DNA making 1 mRNA Uses DNA PolymeraseUses RNA polymerase Happens when cell splitsHappens all the time

11 Translation Cell uses information from mRNA to produce proteins –tRNA brings amino acids to the mRNA chain –Anticodon on tRNA binds to codon on mRNA –Amino Acids are bonded to each other in a process called elongation

12

13 Section 12-3

14 Translation Video Click HEREHERE

15 Activity Transcribe and then Translate the following DNA code into a protein chain. ATTACACCGCATATACTAAC

16 Homework Explain the entire process for creating a protein (transcriptions and translation) –Use the following DNA code to help you: TCTACGCAAAGACCTTAGCATATAACACTTAG –Use pictures or drawings to illustrate what is happening in each step –Use the following vocab words: RNA polymerase, Codon, Anticodon, Elongation, DNA, mRNA, tRNA, amino aicd, protein


Download ppt "Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to."

Similar presentations


Ads by Google