1. GBIO0009-1 Bioinformatics Introduction to DB

2. Instructors Practical sessions Kyrylo Bessonov (Kirill) Office: B37 1/16 kbessonov@ulg.ac.be Office hours: by appointment

3. Overview 1.Introduction to public databases 2.Databases demo HW 3.The submission system

4. What are we looking for? Data & databases

5. Biologists Collect Lots of Data Hundreds of thousands of species to explore Millions of written articles in scientific journals Detailed genetic information: gene names phenotype of mutants location of genes/mutations on chromosomes linkage (distances between genes) High Throughput lab technologies PCR Rapid inexpensive DNA sequencing (Illumina HiSeq) Microarrays (Affymetrix) Genome-wide SNP chips / SNP arrays (Illumina) Must store data such that Minimum data quality is checked Well annotated according to standards Made available to wide public to foster research

6. What is database? Organized collection of data Information is stored in "records“, "fields“, “tables” Fields are categories Must contain data of the same type (e.g. columns below) Records contain data that is related to one object (e.g. protein, SNP) (e.g. rows below) SNP IDSNPSeqIDGene+primer-primer D1Mit160_110.MMHAP67FLD1.seqlymphocyte antigen 84AAGGTAAAAGGCAAT CAGCACAGCC TCAACCTGGAGTCAGA GGCT M-05554_112.MMHAP31FLD3.seqprocollagen, type III, alpha TGCGCAGAAGCTGA AGTCTA TTTTGAGGTGTTAATGG TTCT

7. Genome sequencing generates lots of data

8. Biological Databases The number of databases is constantly growing! - OBRC: Online Bioinformatics Resources Collection currently lists over 2826 databases (2013)OBRC: Online Bioinformatics Resources Collection

9. Main databases by category Literature PubMed: scientific & medical abstracts/citationsPubMed Health OMIM: online mendelian inheritance in manOMIM Nucleotide Sequences NucleotideNucleotide: DNA and RNA sequences Genomes Genome: genome sequencing projects by organismGenome dbSNP: short genetic variationsdbSNP Genes Protein: protein sequencesProtein UniProt: protein sequences and related informationUniProt Chemicals PubChem Compound: chemical information with structures, information and linksPubChem Compound Pathways BioSystems: molecular pathways with links to genes, proteinsBioSystems KEGG Pathway: information on main biological pathwaysKEGG Pathway

10. Growth of UniProtKB database UniProtKB contains mainly protein sequences (entries). The database growth is exponential Data management issues? (e.g. storage, search, indexing?) Source: http://www.ebi.ac.uk/uniprot/TrEMBLstatshttp://www.ebi.ac.uk/uniprot/TrEMBLstats number of entries

11. Primary and Secondary Databases Primary databases REAL EXPERIMENTAL DATA (raw) Biomolecular sequences or structures and associated annotation information (organism, function, mutation linked to disease, functional/structural patterns, bibliographic etc.) Secondary databases DERIVED INFORMATION (analyzed and annotated) Fruits of analyses of primary data in the primary sources (patterns, blocks, profiles etc. which represent the most conserved features of multiple alignments)

12. Primary Databases Sequence Information –DNA: EMBL, Genbank, DDBJ –Protein: SwissProt, TREMBL, PIR, OWL Genome Information – GDB, MGD, ACeDB Structure Information – PDB, NDB, CCDB/CSD

13. Secondary Databases Sequence-related Information –ProSite, Enzyme, REBase Genome-related Information –OMIM, TransFac Structure-related Information –DSSP, HSSP, FSSP, PDBFinder Pathway Information –KEGG, Pathways

14. GenBank database Contains all DNA and protein sequences described in the scientific literature or collected in publicly funded research One can search by protein name to get DNA/mRNA sequences The search results could be filtered by species and other parameters

15. GenBank main fields

16. NCBI Databases contain more than just DNA & protein sequences NCBI main portal: http://www.ncbi.nlm.nih.gov/http://www.ncbi.nlm.nih.gov/

17. Fasta format to store sequences Saccharomyces cerevisiae strain YC81 actin (ACT1) gene GenBank: JQ288018.1 >gi|380876362|gb|JQ288018.1| Saccharomyces cerevisiae strain YC81 actin (ACT1) gene, partial cds TGGCATCATACCTTCTACAACGAATTGAGAGTTGCCCCAGAAGAACACCCTGTTCTT TTGACTGAAGCTCCAATGAACCCTAAATCAAACAGAGAAAAGATGACTCAAATTATGT TTGAAACTTTCAACGTTCCAGCCTTCTACGTTTCCATCCAAGCCGTTTTGTCCTTGTA CTCTTCCGGTAGAACTACTGGTATTGTTTTGGATTCCGGTGATGGTGTTACTCACGT CGTTCCAATTTACGCTGGTTTCTCTCTACCTCACGCCATTTTGAGAATCGATTTGGCC GGTAGAGATTTGACTGACTACTTGATGAAGATCTTGAGTGAACGTGGTTACTCTTTCT CCACCACTGCTGAAAGAGAAATTGTCCGTGACATCAAGGAAAAACTATGTTACGTCG CCTTGGACTTCGAGCAAGAAATGCAAACCGCTGCTCAATCTTCTTCAATTGAAAAATC CTACGAACTTCCAGATGGTCAAGTCATCACTATTGGTAAC The FASTA format is now universal for all databases and software that handles DNA and protein sequences Specifications: One header line starts with > with a ends with [return]

18. OMIM database Online Mendelian Inheritance in Man (OMIM) ”information on all known mendelian disorders linked to over 12,000 genes” “Started at 1960s by Dr. Victor A. McKusick as a catalog of mendelian traits and disorders” Linked disease data Links disease phenotypes and causative genes Used by physicians and geneticists

19. OMIM – basic search Online Tutorial: http://www.openhelix.com/OMIMhttp://www.openhelix.com/OMIM Each search results entry has *, +, # or % symbol # entries are the most informative as molecular basis of phenotype – genotype association is known is known Will do search on: Ankylosing spondylitis (AS) AS characterized by chronic inflammation of spine

20. OMIM-search results Look for the entires that link to the genes. Apply filters if needed Filter results if known SNP is associated to the entry Some of the interesting entries. Try to look for the ones with # sign

21. OMIM-entries

22. OMIM Gene ID -entries

23. OMIM-Finding disease linked genes Read the report of given top gene linked phenotype Mapping – Linkage heterogeneity section Go back to the original results Previously seen entry *607562 – IL23R

24. PubMed database PubMed is one of the best known database in the whole scientific communityPubMed Most of biology related literature from all the related fields are being indexed by this database It has very powerful mechanism of constructing search queries Many search fields ● Logical operatiors (AND, OR) Provides electronic links to most journals Example of searching by author articles published within 2012-2013

25. References [1] Durinck, Steffen, et al. "BioMart and Bioconductor: a powerful link between biological databases and microarray data analysis." Bioinformatics 21.16 (2005): 3439-3440. [2] Hamosh, Ada, et al. "Online Mendelian Inheritance in Man (OMIM), a knowledgebase of human genes and genetic disorders." Nucleic acids research30.1 (2002): 52-55. [3] Ihaka, Ross, and Robert Gentleman. "R: a language for data analysis and graphics." Journal of computational and graphical statistics 5.3 (1996): 299-314.

26. Demo homework Exploring OMIM and PubMed databases

27. Demo HW assignment (1) Question 1: Inherited Disease Genes In this question, you will choose a human disease and find the GenBank accession numbers and sequences of some genes which are thought to affect it. 1)Go to the OMIM database: http://www.ncbi.nlm.nih.gov/omimhttp://www.ncbi.nlm.nih.gov/omim 2)Perform a search for a human disease you are interested in. Some possibilities include: Leukaemia, Breast cancer, Crohn, IBD. You can choose any other disease 3)Print the first page of the search results and circle two results in the printout which you will use to find related to the disease nucleotide sequences (i.e. genes). (Not every item in the search results is related/linked to a sequence)

28. Demo HW assignment (2) 4)For each of the two circled entries, follow the links to a GenBank database (Note that some of the sequences you will see in the first list may not be human.) 5)Display the chosen nucleotide sequences of the disease- related genes in FASTA format as Plain Text and copy&paste it below (only the 1 st 5 lines, do not copy whole FASTA file)

29. Demo HW assignment (3) Question 2: Medical Articles In this question, you will search for articles on your chosen disease and restrict your search in various ways. 1)Go to the PubMed database: http://www.ncbi.nlm.nih.gov/pubmedhttp://www.ncbi.nlm.nih.gov/pubmed 2)Perform a search for the same human disease as you used for OMIM. Write down how many articles are out there? Provide below the search key word(s) used to obtain the results 3)Perform the same search, only for articles which appeared exactly within the 2013 year. How many did you found? Provide below the exact query search key words used to obtain the results (e.g. ([Author] …) AND ([Journal] …) ) and or graphical explanation on how the publication date filter was applied 4)Print the Abstracts of the first 5 search results

30. Assignment Submission Step by Step Guide

31. Assignment submission All assignments should be zipped into one file (*.zip) and submitted online Create a submission account

32. Account creation Any member of the group can submit assignment Account details will be emailed to you automatically All GBIO009-1 students should create an account

33. Submit your assignment After account creation login into a submission page The remaining time to deadline is displayed. Good idea to check it from time to time in order to be on top of things File extension should be zip Can submit assignment as many times as you wish

35. Next class bring PC for R installation! Next class form groups of 2-3 persons to work on HW