1. Introduction to DNA microarrays DTU - May 2008 - Hanne Jarmer

2. Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go CELL RNA

3. How? gene specific DNA probes labeled target gene mRNA

4. Microarrays - The Technologies Stanford-type Microarrays High-density

5. Stanford-type Microarrays

6. Coating glass slides Deposition of probes Post-processing Hybridization

7. Spotting - Mechanical deposition of probes

8. 16-pin microarrayer

10. Microarrayer

11. mRNA cDNA Cy3-cDNACy5-cDNA SAMPLE CONTROL Stanford microarrays

12. Affymetrix GeneChip ® oligonucleotide array 11 to 20 oligonucleotide probes for each gene On-chip synthesis of 25 mers ~20,000 genes per chip good quality data 280-500 K features to play with

13. Photolithography Mask #1 in situ synthesis Spacers bound to surface with photolabile protection groups

14. Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups Mask #1

15. Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups

16. Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups Mask #2

17. Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups Mask #2

18. Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups

19. Photolithography in situ synthesis Spacers bound to surface with photolabile protection groups

20. Sample Preparation - Eberwine RNA T7 dsDNA T7 pol SAMPLE ssDNA + Reverse Transcriptase + RNase H + Polymerase clean up dsDNA + Biotin-labeled nucleotides aRNA 42  C 2 h 16  C 2 h 37  C 6 h 70  C 10 min

21. Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( )

22. Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( )

23. Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-SAPE IgG

24. Detection of Biotin (Affymetrix) biotinylated anti-anti IgG

25. Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) biotinylated anti-anti IgG

26. The Affymetrix GeneChip ® A gene is represented like this: - Perfect Match (PM) - MisMatch (MM) PM MM PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT

27. NimbleGen 385,000 to 2.1 mill features Long probes (up to 70 nt) Service: -labelling -scanning -image analysis

28. Photolithography - Micromirrors

29. Tiling arrays Tiling arrays are used for determation of genes, ncRNAs, TF-binding sites,...

32. Sample Preparation Hybridization Array design Probe design Question Experimental Design Buy Chip/Array Statistical Analysis Expression Index Calculation Advanced Data Analysis ClusteringPCAClassification Promoter Analysis Meta analysisRegulatory Network Comparable Gene Expression Data Normalization Image analysis The DNA Array Analysis Pipeline