Presentation is loading. Please wait.

Presentation is loading. Please wait.

Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week.

Similar presentations


Presentation on theme: "Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week."— Presentation transcript:

1 Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week Discussion of Article 3

2 Experiment 3 Goal: To introduce basic procedures used to manipulate DNA. General procedures are DNA fragment isolation, ligation of DNA, transformation of bacteria, small scale DNA isolation.

3 Lab 6 DNA fragment isolation kit A Vector preparation B Fragment isolation

4 Lab 7 Ligation of vector and DNA fragment T4 DNA ligase

5 How do we ligate a XhoI and Sal I site together? GTCGAC SalI CTGCTG CTCGAG XhoI GAGCTC

6 Lab 8 A. Run ligation reactions on an agarose gel B. Transform bacteria

7 Lab 9 Blue white selection (screen)

8 Lab 10 and 11 Small scale DNA isolation (Lab 2) Restriction enzyme digestion (Lab 3)

9 Experiment 4 Goal: to characterize the response of light regulated genes. Method: RT-PCR. General take home messages: Use of RT-PCR to measure levels of transcript accumulation; use of mutants to characterize a biological process; environmental regulation of gene expression.

10 Etiolation and det1

11 Experimental set up

12 1. wild-type grown in the light 2. wild-type grown in the dark 3. det1 grown in the light 4. det1 grown in the dark What are the expression levels of light regulated genes (chlorophyll a/b binding proteins CHAB and CLAB) using tubulin as loading control. -Extract RNA -RT mRNA -PCR cDNA WT-light WT-dark det1-light det1-dark Ladder WT-light WT-dark det1-light det1-dark CHABCLAB TUB CHAB or CLAB Picture of Plants (WT and mutant)

13 Isolation of RNA using Commercial Trizol Reagent Liquid N 2 Trizol Homogenize Phenol Chloroform RNA Isopropyl alcohol Ppt RNA DEPC H 2 O Trizol:-mono-phasic solution of phenol and guanidine isothiocyanate -lyses cells and dissolves cell components while maintaining integrity of RNA Chloroform: separate aqueous and organic phases (RNA is in the top aqueous phase) Isopropanol: Precipitates RNA 75% Ethanol: Wash RNA pellet DEPC (Diethylpyrocarbonate) water: Resuspend RNA pellet in RNAse-free water DEPC interacts with the active site histidine residue of RNAse and irreversibly inactivates RNAses. Aq Org 75% EtOH

14 Assignment 1

15 Example sequence GGTAANGGAACTGGAATCCAAACTCTCTGAAGCTGAGAAGGAATTCATCGA AGGAGCACCAACACGTAGCAAACGATCACCATCCGAGTGGATACCAAGGCCACCCGAAAAATACAGTCTTACTGGGCACA GAGCTCCTATCAACAGAGTTATTTTCCATCCGGTCTTTAGTCTTATAGTATCTGCCAGCGAAGATGCCACTATCAAGGTG TGGGACTTCGAGAGCGGCGAATTCGAAAGAACGTTGAAGGGGCACACCGACAGCGTGCAGGACGTTTCCTTCGACGTCTC CGGGAAACTGTTAGTCTCATGCAGTGCGGACATGTCTATTAAGTTATGGGACTTTCACCAGTCATTCGCCTGCGTGAAAA CCATGCACGGACATGATCACAGTGTCAGCTCTGTCGCATTTGTGCCACAAGGGGATTTCGTAGTGAGCGCCTCTAGGGAT AAGACCATCAAAATATGGGAAGTAGCGACAGGGTATTGTGTCAAAACGTTAACGGGGCACAGAGAATGGGTACGGATGGC CAGAGTCAGTCCTTGTGGAGAATTAATAGCTAGTTGCTCGAACGATCAAACAGTACGGGTTTGGCACGTGGCAACAAAGG AAACGAAGGTCGAACTCAGAGACCACGAACACGTAGTGGAGTGTATCGCATGGGCACCGGACAGTGCAAGAGCATCGATC AACGCTGCTGCAGGGGCGGACAATAAGGGAGCCCATGAAGGACCTTTCCTCGCATCTGGCTCGCGAGACAAAGTAATTCG TGTATGGGATGTCGGTGCCGGTGTTTGTCTCTTCGCCCTATTGGGCCACGACAACTGGGTTCGCGGCATCGTCTTCCATC CTGGTGGCAAGTTCATCGTCAGTGNCTCTGACGACAAGANCCTGCGAGTATNGGANACGCGCAACANANGGGTAATGAAA ACCCTCNAAGCGCACGTCCACTTCTGCNCCTCCNTTGATTTCACAAAAGCCATCCTTACGTGGTCNCCGGTAGTG

16 Step into liquid

17 I will be available for a large-scale public consultation on Friday from 4:00PM until we are done. Bring your laptops. You can make appointments for consultation as well. Time is running out. Assignment 1 due next Monday Oct. 27, 2008 Assignment 1

18 Discussion of Article 3

19

20

21

22 Taken from Hall J. C. Science

23 Taken from Hall Science

24

25


Download ppt "Lecture 6 Experiment 3: Basic subcloning Flowchart Experiment 4: Light regulated genes Principles and process of RNA isolation Assignment 1 due next week."

Similar presentations


Ads by Google