1. Integrative Informatics Life Sciences Conference + Expo April 3 rd, 2006 – Boston, MA John Reynders Information Officer - LRL Discovery and Development Informatics

2. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Outline Cant we all just get along? Navigating silos of silos Integrative Informatics

3. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Rapid Application Development with the Parallel Object-Oriented Methods and Applications (POOMA) Framework Post-Doc Challenge: Write a 3D Pseudo-Spectral code to simulate two colliding vortices using the Navier-Stokes Equations Advanced Computing Lab Los Alamos National Lab

4. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Rapid Application Development with the Parallel Object-Oriented Methods and Applications (POOMA) Framework Post-Doc Challenge: Write a 3D Pseudo-Spectral code to simulate two colliding vortices using the Navier-Stokes Equations Advanced Computing Lab Los Alamos National Lab On This:

5. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Rapid Application Development with the Parallel Object-Oriented Methods and Applications (POOMA) Framework Post-Doc Challenge: Write a 3D Pseudo-Spectral code to simulate two colliding vortices using the Navier-Stokes Equations Result: One Post-Doc with no parallel experience wrote this application in 5 weeks with POOMA Navier-Stokes simulation iso-surface of vorticity Advanced Computing Lab Los Alamos National Lab

6. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Encapsulation in the POOMA FrameWork STL Expression Templates User threads RefCount & Data Pooling MPI/PVM Domain Decomp RTS Sheduling Load Balancing FieldsMatrices Particles Meshes FFT Elliptic Solvers Stencil Operations DP MonteCarlo ER Plasmas DP Hydro ER Ocean Global Algorithm Computer Science Stencil Operators Interpolators PhysicsApplicationLocal Parallel Advanced Computing Lab Los Alamos National Lab

7. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Outline Cant we all just get along? Navigating silos of silos Integrative Informatics

8. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company The Problem: Silos of Silos Tools, application, and data are standalone with limited interaction Scientists have great difficulty finding their data and associated tools Asking cross-domain questions ( e.g. bio+chem ) very difficult Support becoming very impractical – estimated 400+ individual tools across silos LLYDB BioSel Jockyss ELIAS Beacon ICARIS Results Star Jubilant BioGeMs Sig3 PathArt TV-GAME PubDBs Proteome Xrep Nautilus Conformia Intellichem MCPACT Watson PRDB LIMS IDW Chem Bio PR&D/ADMET

9. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company PRESENTATION LAYER (.NET) WORK FLOW / BUSINESS LAYER (Some. Net) DATA LAYER BioGems Going from the vertical to the horizontal DATA LAYER Biosel/TINS DATA LAYER Process Tracking DATA LAYER Data Warehouse DATA LAYER.Net?...

10. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Lilly Science Grid (LSG) Architecture - Systems TDC-TAT Plug-In Manager BiologyChemistryToxicology BioGEMSTV-GAMEBioSelSystem X WS Provider WS Consumer WS Provider WS Cons WS Provider SAP Portfolio Portfolio Sys WS Provider Plug-In APlug-In BPlug-In N … WS Cons Event Communication TAO

11. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company LSG Architecture - Tools View TDC-TAT.NET API SRS/OracleOracle Perl CGI Java SOAP::Lite Perl SOAP::LiteAxis.NET Proxy SOAP::Lite Flat Files/ Oracle Java Axis.NET User Ctrl.NET User Ctrl.NET User Ctrl ….NET Proxy.NET API Oracle.NET C# IIS Web Server Visual Studio Apache Web Server Linux Tomcat Web Server Linux WSDL Common XML Schemas (XSD)

12. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Thick Client POC Interface Webparts Thin Client POC Interface Portfolio WS Spreadsheet of Portfolio Active Cpds WS BIOSEL/TINS Prot. Express. WS GeneAltas/BioGems Prot. Express. WS Proteome/BioGems Prot. Express. WS Proteome/BioGems Prot. Express. WS Proteome/BioGems Data WebLinks. WS BioGems/TV-GAMES … Gene ID Mapping WS Custom Spreadsheet Data Integration/Mapping Architecture enables encapsulation and division of labor

13. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Grid Architecture Points: The User MyScience: Enable Scientist to dynamically compose their environment from a set of components Orchestration: Components communicate to enable an action/question in one component to yield results/answers from multiple components Organic: New capabilities can be added by simply adding a new component Scalable: The combinatorics of using 4 out of 12 components yields 495 configurations It is much easier to maintain a framework and 12 associated components than 495 separate tools!

14. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Grid Architecture Points: The Developer Get SEs and scientists out of silos and into layers so they may do what they do best Data, applications, algorithms, presentation Plug-in architecture to factor business/science and framework development Crisp abstraction barriers between and within layers to enable modular development Rationalize tool set within layers to improve developer productivity

15. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Some Observations/Thoughts Where is the Value: Data fusion in the military – information supremacy –F15 heads-up display –Aegis cruiser –Bob and Tom from the NSA What makes the drug hunter effective in an Informatics cockpit –Its partly the quality, speed, accuracy of any given tool ( e.g. the altimeter ) –Its mostly how the instruments work as an integrated whole I can ask questions I could not ask before! –Integrate to this point of innovation – before spending significant time on optimizations Some Lessons from Los Alamos: How can one go wrong having an application framework built by a team of A+ students? –By building a framework that can only be used by A+ students Surely everyone knowing as much as they can about all aspects of the framework will produce the best framework! –Nope. By knowing the implementation behind the abstraction, a team fails to program through interface contracts –Also, the team has challenges scaling in development efforts – because it is not functioning as a team ( everyone run to the soccer ball? )

16. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company The old vs. the new architecture Benefits: rapid development, customizable environment, integration of tools for cross-domain inquiry, reduced support load… plugin Discovery Informatics Integration Kernel plugin Jubilant BioGeMs Sig3 PathArt TV-GAME PubDBs Proteome Xrep

17. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Web-Service Layer - LSG Can accelerate staging the old into the Lilly Science Grid Discovery Integration Kernel plugin Integrated Data Layer - LSG BioGeMs PathArt

18. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Web-Service Layer Scaling efforts: Divide & Conquer The Kernel Composability, Integration, Interaction, Scalability Clear contract with plug-ins The Plug-in Clear contract with kernel and web-service layer Domain-specific tool Limited knowledge of Kernel required to build plug-in Web-Services Clear contract with plug-ins and data-layer Insert web-service layers into tools – preserving legacy interface and creating service to build a plug-in Integrated Data Layer Clear contract with Web-Services Design for integration first, optimization next Automate ETL Discovery Integration Kernel plugin Integrated Data Layer

19. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company

20. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Indications view

21. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Drug Hunting Team view

22. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Outline Cant we all just get along? Navigating silos of silos Integrative Informatics

23. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Similarity? ~ Graph - yes. Text - yes Assay - yes

24. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Similarity – and adding a magical Methyl ~ Graph - yes. Text - yes Assay - yes ~ Graph - yes Text - maybe Assay - no

25. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Gene Objects Representation Name String Filters PathwaySet GeneFamily GO Measures Alignment (Algorithm) Text (DocumentSet) GeneExpression (SampleSet, MoleculeSet ) ATGAGCCTCCCCAATTCCTCCTGCCTCTTAGAAGACAAGATGTGTGAGGGATGCCA

26. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Protein Objects Representation Gene String State ( e.g., Phosphorelated ) Filters GeneFamily GO Measures Alignment (Algorithm) Pathway (PathwaySet) Text (DocumentSet) ProteinExpression (SampleSet, MoleculeSet ) Assay ( ExperimentSet ) 3D Structure (Algorithm)

27. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company SNP Objects Representation Gene Locus Filters GeneSet SNP characterization –Coding/Non-Coding –Blossum Score –Exon/Intron –Transcriptional Measures Linkage disequilibrium –D-Prime –R-Squared Haplotype Block Association Text (DocumentSet) ATGAGCCTCCCCAA TTCCTCCTACCTCT TCGGAGACAAGATG TGTCAGGGATGCCA ATGAGCCTCCCCAA TTCCTCCTGCCGCT TCGAAGACAAGATG TGTCAGGGATGCCA ATGAGCCTCCCCAA TTCCTCCTACCTCT TAGGAGACAAGATG TGTCAGGGATGCCA

28. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Image Objects Laws Texture Convolution L5 = [ 1 4 6 4 1 ] E5 = [ -1 -2 0 2 1 ] S5 = [ -1 0 2 0 -1 ] W5 = [ -1 2 0 -2 1 ] R5 = [ 1 -4 6 -4 1 ] Density Functional Signature ( DFS ) Target DFS + L2 Measure Measure Filter Representation - 2D Matrix

29. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Molecule Objects Representation Name Graph 3D Structure Filters Library Compounds Similarity Search Measures Text (DocumentSet) Fingerprints (Algorithm) 2D/3D Similarity (Algorithm) HTS (GeneSet)

30. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Compound Profiling Bioprint Target Chemoprint Chemogenomic Selectivity profiles

31. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Comparison of kinase dendograms Assay Sim. Sequence Sim.

32. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company HTS as a Mapping Object Representation ProteinSet MoleculeSet HTS Array Filters Protein Filters Molecule Filters Measures Cluster Analysis Self-Organizing Maps Support Vector Machines Neural Networks

33. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Gene Expression as a Mapping Object Representation GeneSet SampleSet 2D Expression Matrix Filters Gene Filters Sample Filters Measures Cluster Analysis Self-Organizing Maps Support Vector Machines Neural Networks

34. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Text as a Mapping Object Representation ObjectSet A ObjectSet B RDF Triplets Filters DocumentSet A Filters B Filters Measures QR Factorization Text-based Classifiers

35. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Pathway as a Mapping Object Representation ProteinSet MoleculeSet VertexSet Filters Protein Filters Molecule Filters Measures Graph Algorithms

36. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company Putting it all together… ObjectsMeasure MTS Literature Binding Coding Clinical DB Compounds Images Genes SNPs Expression Linkage D Signature Fingerprint Map 1Map 2

37. Life Sciences C+E 2006, Boston MA Copyright © 2006 Eli Lilly and Company The goal… find wormholes 9101112 5678 1234 13141516 16 Objects 20 Text-based relations: Text Pathway HTS Expression Image 16 Objects 120 heterogeneous relations: