Presentation is loading. Please wait.

Presentation is loading. Please wait.

A Pilot Study of the Effects of Contaminants on Shiner Surf Perch in the San Francisco Bay-Estuary Robert Spies, AMS Kathrine Springman, UC Davis July.

Similar presentations


Presentation on theme: "A Pilot Study of the Effects of Contaminants on Shiner Surf Perch in the San Francisco Bay-Estuary Robert Spies, AMS Kathrine Springman, UC Davis July."— Presentation transcript:

1 A Pilot Study of the Effects of Contaminants on Shiner Surf Perch in the San Francisco Bay-Estuary Robert Spies, AMS Kathrine Springman, UC Davis July 2006

2 Problem Populations of many fish in the SF Estuary and its watershed are in a long-term decline. Populations of many fish in the SF Estuary and its watershed are in a long-term decline. There are many possible causes of the these declines including habitat loss, harvest, introduced species, and contaminants. There are many possible causes of the these declines including habitat loss, harvest, introduced species, and contaminants. Contaminants probably are having a negative effect on some populations. Contaminants probably are having a negative effect on some populations.

3 Early gametogenesis: yolk Late gametogenesis: Internal fertilization femalesmales implantation gestation birth Recreational fishing Habitat damage Disease resistance Growth Mating Foraging sewage, street runoff, Ag runoff, atmospheric sources, etc. PAH organophos- phate pesticides pharma- ceuticals, DDTs, PCBs, chlorinated pesticides, carbamate pesticides Breeding population Conceptual model for shiner surf perch declines

4 Objective Determine if shiner surfperch (Cymatogaster aggregata; Embiotocidae) show effects of contamination on some aspect of their fitness, growth or reproduction.

5 Strategy : 1. Field studies relating exposure to fitness, growth, and reproduction. 2. Establish surfperch culture for possible laboratory exposure experiments.

6 Todays report 2006 goals 2006 goals Collection and analyses to date Collection and analyses to date Culture started Culture started Sex ratios Sex ratios Condition indices Condition indices Number young Number young Weight young Weight young Gonadosomatic indices Gonadosomatic indices Histopathology Histopathology E2 injection experiment E2 injection experiment Choriogenin measures Choriogenin measures EROD activities EROD activities Genetic analyses Genetic analyses

7 Field studies-2006 Goals Collect 20+ fish each from 2 contaminated; 1 less-contaminated sites. New control site. Collect 20+ fish each from 2 contaminated; 1 less-contaminated sites. New control site. Measurements: length, weight, sex, no. young, size of young, gonad weight. Measurements: length, weight, sex, no. young, size of young, gonad weight. Analyses: organic chemicals (carcass), P4501A (adult liver,viscera of young). Analyses: organic chemicals (carcass), P4501A (adult liver,viscera of young). EROD (liver), choriogenin. EROD (liver), choriogenin. Mother-vs-offspring measures: morphometrics,P4501A, some histopathology. Mother-vs-offspring measures: morphometrics,P4501A, some histopathology.

8 Progress to date I: Field studies in 2006 Collected 20+ adults by beach seine from Oakland Middle Harbor (5/20/06). Collected 20+ adults by beach seine from Oakland Middle Harbor (5/20/06). Collected 26 fish by beach seine from State Park Beach at Candlestick Park, So. San Francisco (5/22/06). Collected 26 fish by beach seine from State Park Beach at Candlestick Park, So. San Francisco (5/22/06). Collected 20 fish in by beach seine at Hearts Desire Beach, SW Tomales Bay (6/1/05). Collected 20 fish in by beach seine at Hearts Desire Beach, SW Tomales Bay (6/1/05). All fish measured, weighed, dissected, sexed, young counted and weighed, tissues stored. All fish measured, weighed, dissected, sexed, young counted and weighed, tissues stored.

9 Progress to date III: Start of culture Caught 56 shiners in Big River on 2/29/06. Caught 56 shiners in Big River on 2/29/06. Transported to Bodega Bay Marine Laboratory Transported to Bodega Bay Marine Laboratory Weighed ea fish. Weighed ea fish. 26 fish in ea of 2 tanks 26 fish in ea of 2 tanks Fed 2% body wt./day. Fed 2% body wt./day. 98% survival. 98% survival.

10 Progress to date III Estradiol injection experiment performed 6/9/06. Estradiol injection experiment performed 6/9/06. Choriongenin assays completed at Bodega Marine Laboratory on estradiol injected fish. Choriongenin assays completed at Bodega Marine Laboratory on estradiol injected fish. Histopathological analyses completed on 2005 fish at Duke University. Histopathological analyses completed on 2005 fish at Duke University. EROD assays on 2006 fish completed. EROD assays on 2006 fish completed. Genetic analyses completed on 2005 fish at Tiburon Center. Genetic analyses completed on 2005 fish at Tiburon Center.

11 General observations All of the fish caught in SF and Tomales Bay were sexually mature. Smaller fish >8 g from Big River in 2005 were generally not sexually mature. All of the fish caught in SF and Tomales Bay were sexually mature. Smaller fish >8 g from Big River in 2005 were generally not sexually mature. All female fish from SF Bay were pregnant except 5 (17%) large females from Candlestick ( ). All female fish from SF Bay were pregnant except 5 (17%) large females from Candlestick ( ). Sex ratio (M:F) ( ) more skewed in SF Bay towards females. Oakland Middle Harbor: 1:10.5;Candlestick Park 1:2.02; Tomales bay 1:1.08 Big River: 1:1.16 Sex ratio (M:F) ( ) more skewed in SF Bay towards females. Oakland Middle Harbor: 1:10.5;Candlestick Park 1:2.02; Tomales bay 1:1.08 Big River: 1:1.16 Hearts Desire Beach, Tomales Bay appears to be a better control than Big River. Hearts Desire Beach, Tomales Bay appears to be a better control than Big River. Big River was colder than SF Bay (05 finding). Big River was colder than SF Bay (05 finding). Big River fish are exposed to p4501A inducers (2005 finding). Big River fish are exposed to p4501A inducers (2005 finding).

12

13

14 Sex p=0.004 EROD p=0.0196

15 Location p=0.007 Weight of mother p=0.001 EROD N.S.

16 Location p=0.02 Wet wt mother p< EROD p=0.001

17

18 Factorial model Location, P= Sex, P=0.0009

19

20

21 2006 EROD activity by location & sex Location p= Sex p<0.0001

22 Examination and scoring of fish from 2005 field collections. 1. Liver, heart, gills and gonad examined. Scored from 0 (normal) to 5 (severe) lesions. 2. Few lesions found. Branchitis: 5/20 fish at Candlestick with branchitis. One w. lamellar aneurisms 0/20 fish at Big River; 0 of 2 at Oakland Ovary: One intersex morphological female from Candlestick Park. Two females with pale ovaries with decreased cell density. Liver: One fish ea from Candlestick and Big River with fatty change. Heart: One fish from Oakland w mild macrophage aggregates Histopathology results

23 Preliminary results Livers of All field fish tested strongly positive with 2 anti-bodies: anti-salmon (Biosense) and anti-herring (BML). Livers of All field fish tested strongly positive with 2 anti-bodies: anti-salmon (Biosense) and anti-herring (BML). 48-hr E 2 injection experiment with 5 mg kg -1 to induce ZRP; uninjected controls, solvent control, injected w E 2. Fish from Big River were used. Plasma of 2 injected fish and controls reacted very weakly with anti-herring choriogenin.No reaction from females. 48-hr E 2 injection experiment with 5 mg kg -1 to induce ZRP; uninjected controls, solvent control, injected w E 2. Fish from Big River were used. Plasma of 2 injected fish and controls reacted very weakly with anti-herring choriogenin.No reaction from females.

24 Choriogenin marker

25 Preliminary choriogenin results (contd) Livers of All field fish tested strongly positive with 2 anti-bodies: anti-salmon (Biosense) and anti-herring (BML). Livers of All field fish tested strongly positive with 2 anti-bodies: anti-salmon (Biosense) and anti-herring (BML). 48-hr E 2 injection experiment with 5 mg kg -1 to induce ZRP; uninjected controls, solvent control, injected w E 2. Shiners from Big River were used. Plasma of injected fish and controls reacted with anti-herring, but not anti- salmon. 48-hr E 2 injection experiment with 5 mg kg -1 to induce ZRP; uninjected controls, solvent control, injected w E 2. Shiners from Big River were used. Plasma of injected fish and controls reacted with anti-herring, but not anti- salmon. Antibody reacts to choriogenin induced by E 2 in 2/5 fish. Marker is not ready to use ion field. Antibody reacts to choriogenin induced by E 2 in 2/5 fish. Marker is not ready to use ion field.

26 TAACCGTTAGTCTTAAGAAATCAACTGATGGTAGGCTCTTACTACATTAAAATTTGGTTCTTGACGAGATGTTGAA TCTTGGTATAACTTGACTTATGAATAGTGTGTTCGGTCTTAAGTTTCTTCCAATTTAATTGAATTTAAAAGTAAAT G TAATAATAATATGTTTTAAGTATATCTTAGGGTTGTGTACTAAACAGAAATGGTTAATATCGTTTAATGGTGATTA G A TACAT ATATATGC ATATATGC ATATATGC ATATATATA--CAT ATATATAAAATTGGCGGAGCCCGGCAAA CAT ATATATGC ATATATGC ATATATGC ATATATATA--TAT ATATATAAAA CAT ATATATGC ATATATGC ATATATGC ATATATATACATAT ATATATAAAA CAT ATATATGC ATATATGC ATATATGC ATATATATATACAT ATATATAAAA CAT ATATATGC ATATATGC ATATATGC ATATATATA----C ATATATAAAA CAT ATATATGC ATATATGC ATATATGC ATATATATA----T ATATATAAAA CAT ATATATGC ATATATGC ATATATGC ATATATACA----T ATATATAAAA GAATAGTTTAGCTTAAGAATCCTAGCTTTGGGA TACCACAGCAGCATTTCTGGCGAGCAACAAAGCAAGACAGAGGGTTTTGATGGCTTGTTAAGTGGTGACAC A TTGGCACATTGTGTGTAACGGTGAGGCGGGGAGATGCAACGGCAAAACGACCGGTTTTGACCCTCTTCTGG CTACCTTGGACTCTCTGTCTCTGGACGGAGAGGAAACATGCTCCAACAGTGAGCTCTTCAGCGCTTTGGAG T AATCTGGGCCTGAACGCTGAGGATCTGGAGCTGCTGCTTCTGGATGAGAGGATGATCCAGGTGGAGCTGGA CCCCAACCACATCCCCACACTCAGTGACCTTCTTACCAACAACGAAATCCTTTCCTACATCCAGGACTCTC TGGATAGCGGGGCAGAGGCAAAGGGACAACAGGACAGAGGTGGGTATGGACCTTCGAGCCATCCATCAAAC T CCAGACTCCTCCCAAAGTGTCTTCCAGCAGGCATGTTTGACGCCTGCTGTCCCTCCAACTCTTCCCAGCAG CAGGCAGCCCATCGTCCAGCTGTCC Sample D-loop Sequence (polymorphisms shown below) Sample AHR1 Sequence (polymorphisms shown below) Single Nucleotide Polymorphisms (SNPs) Length Variation Mitochondrial genetic variation in the dloop region for population connectivity estimates in shiner surfperch (Cohen, Schinske, and Spies)

27 Bodega Harbor Big River Distribution of AHR1 Alleles at 3 Sites Different colors in pie charts represent different alleles. n = 12 n = 9 n = 18 Cohen, Schinske, Spies

28 Bodega Harbor Big River Distribution of D-Loop Alleles at 3 Sites SNP Alleles (Left) and Length Variation Alleles (Right) n = 18 n = 10 n = 19 Cohen, Schinske, and Spies

29 Current surfperch genetic data AHR1 AHR1 Low variation in initial exon 10 transcriptional control region. Consider catalytic and other functional regions/loci, wrt functional assays. D-loop D-loop No indication of population subdivision between Big River, Bodega, and San Francisco based on dloop SNPs. Additional sampling would make repeat region data informative.

30 Observations and thoughts Sex ratios continue to suggest some possible estrogenic effects in SF Bay. When is sex of young fixed? Tools? Sex ratios continue to suggest some possible estrogenic effects in SF Bay. When is sex of young fixed? Tools? Males in SF Bay: fewer, lower condition and lower GSI than controls. Is there poor survival of males in SF Bay? Endocrine disruption effect? Males in SF Bay: fewer, lower condition and lower GSI than controls. Is there poor survival of males in SF Bay? Endocrine disruption effect? Females from Oakland with greater number of young (accounting for effect of mothers weight). Females from Oakland with greater number of young (accounting for effect of mothers weight). Condition index and weight of offspring are correlated with EROD. Condition index and weight of offspring are correlated with EROD. Are EDCs accelerating sexual maturity and fecundity? Is there a cost to the population? Are EDCs accelerating sexual maturity and fecundity? Is there a cost to the population?

31 Acceleration of oogenesis in kelp bass dosed with DDT and PCB

32 Priorities for additional work in Histology of gonads to look for abnormalities. Status of developing oocytes. 2. Chemical analyses of carcasses. 3. Testosterone and estradiol in plasma. 4. Otolith work to age fish. Age structure of populations. 5. Analysis of EROD data.

33 The Problem The relative binding capacity of synthetic chemicals to hormone receptors may be 1/100 to 1/1000 of that of the natural ligand (e.g., estrogen) and the chemical concentration may exceed the effective concentration by 100 to 10,000 X.

34 The Problem: there are numerous and complex endocrine interactions in reproduction and growth of fishes (sensory input-endocrine cascades--feedback loops)

35 Agonist for gonadotropin I acceleration of gametogenesis

36 Sex determination

37 Starry flounder in SF Bay Reproductive success in relationship to a biomarker of contaminant exposure

38 Shiner surf perch is a good choice Accumulate high concentrations of contaminants (Davis et al., 2001). High site fidelity (Fritzsche and Collier 2001). Occur from Alaska to Mexico. Habitat is in shallows and channels where RMP chemical data taken since Analyzed by the sport fish program, included in the Pacific States Marine Recreational Fisheries Statistics Survey, & the IEP. Favorite of urban fishermen. Populations in decline. Live-bearers --annual reproductive output (4-36 young annually) can be determined in early spring and summer.

39 The evidence so far: contaminants 1. Starry flounder reproductive dysfunction linked to P4501A and PCBs (Spies & Rice, 1988). 2. Sex reversal and estrogenic effects in longjaw mud suckers (Cherr et al., unpubl.). 3. Chinook salmon in upper watershed show high proportions of females that are phenotypically male (Williamson and May, 2002). 3. Striped bass larval growth and histology negatively affected (Ostrach, unpubl.). 4. Speckeld sanddab histology (Spies et al., 1993; Gunther et al. 1997). 5. Herring egg abnormal development (Vines et al., 2000).

40


Download ppt "A Pilot Study of the Effects of Contaminants on Shiner Surf Perch in the San Francisco Bay-Estuary Robert Spies, AMS Kathrine Springman, UC Davis July."

Similar presentations


Ads by Google