Presentation is loading. Please wait.

Presentation is loading. Please wait.

Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial.

Similar presentations


Presentation on theme: "Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial."— Presentation transcript:

1 Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial Disorders Childrens Hospital at Montefiore Bronx, New York February 2, 2006

2 Faculty Disclosure Information In the past 12 months, I have not had a significant financial interest or other relationship with the manufacturer(s) of the product(s) or provider(s) of the service(s) that will be discussed in my presentation.In the past 12 months, I have not had a significant financial interest or other relationship with the manufacturer(s) of the product(s) or provider(s) of the service(s) that will be discussed in my presentation. This presentation will not include discussion of pharmaceuticals or devices that have not been approved by the FDA or of off-label uses of pharmaceuticals or devices.This presentation will not include discussion of pharmaceuticals or devices that have not been approved by the FDA or of off-label uses of pharmaceuticals or devices.

3 Congenital Hearing Loss Epidemiology Epidemiology 1/1000 infants affected 1/1000 infants affected Etiology Etiology 50% genetic 50% genetic 70% non-syndromic sensorineural hearing loss (SNHL) 70% non-syndromic sensorineural hearing loss (SNHL) 77% autosomal recessive 77% autosomal recessive 52 loci known; 34 identified 52 loci known; 34 identified 22% autosomal dominant 22% autosomal dominant Remainder are mitochondrial or X-linked Remainder are mitochondrial or X-linked

4 Clinical evaluation of hearing loss History Prenatal Infections, medication exposure Neonatal Prematurity, hyperbilirubinemia, infections, medications Childhood Ear infections, antibiotics, medical problems Family history

5 Clinical evaluation of hearing loss Physical exam Physical exam Dysmorphic features Dysmorphic features Ear malformations or effusions Ear malformations or effusions Skin (NF2) Skin (NF2) Hair and eyes (Waardenburg) Hair and eyes (Waardenburg) Testing Testing EKG (Jervell and Lange-Nielsen syndrome) EKG (Jervell and Lange-Nielsen syndrome) +/- urinalysis +/- urinalysis CT scan of temporal bones CT scan of temporal bones Genetic testing Genetic testing

6 GJB2 Encodes connexin 26 (Cx26) Encodes connexin 26 (Cx26) Gap junction protein in the cochlea Gap junction protein in the cochlea Maps to 13q12 Maps to 13q nucleotides, 680 amino acids 2263 nucleotides, 680 amino acids Two exons; one coding exon Two exons; one coding exon CpG island near Exon 1 CpG island near Exon 1

7 GJB2 AR mutations account for 15 – 40% of inherited SNHL in North America AR mutations account for 15 – 40% of inherited SNHL in North America Carrier rate of 1:33 in Europeans Carrier rate of 1:33 in Europeans Most common mutation in Caucasians: 35delG Most common mutation in Caucasians: 35delG Mutation spectrum is known to differ by ethnic group Mutation spectrum is known to differ by ethnic group

8 Gap Junction Channels From Rabionet et al in TRENDS in Molecular Medicine Vol.8 No.5 May 2002

9 Expression of Cx26, Cx30 and Cx31 in the Cochlea From Rabionet et al in TRENDS in Molecular Medicine Vol.8 No.5 May 2002

10 Preliminary Study Chart review of 107 patients Chart review of 107 patients Referred to CHAM for genetic evaluation of SNHL Referred to CHAM for genetic evaluation of SNHL Data collected: Data collected: Ethnicity Ethnicity Cx26 mutation status Cx26 mutation status mtDNA DNA analysis (nt 1555, 7445, 3243, sequencing of 12s rRNA) mtDNA DNA analysis (nt 1555, 7445, 3243, sequencing of 12s rRNA) CT scan of temporal bones CT scan of temporal bones

11 Available Samples 107 Samples obtained from IRB approved research project looking for mtDNA point mutations in SNHL 107 Samples obtained from IRB approved research project looking for mtDNA point mutations in SNHL 192 Controls provided by Dr. Robert Burk from HPV study 192 Controls provided by Dr. Robert Burk from HPV study

12 mtDNA and CT Results one Puerto Rican patient: one Puerto Rican patient: A503G variant + mtDNA mutation at nt 1465 A503G variant + mtDNA mutation at nt 1465 no patient had A1555G or T7445C associated with SNHL no patient had A1555G or T7445C associated with SNHL 31 patients had CT scan results: 31 patients had CT scan results: 2 had EVA, one of which carries G79A 2 had EVA, one of which carries G79A 1 had ? Mondinis, 1 had prominence of cochlear aqueducts, 1 had diffuse atrophy 1 had ? Mondinis, 1 had prominence of cochlear aqueducts, 1 had diffuse atrophy

13 Project design 1. Designing primers for PCR 1. Overcoming the GC content 2. Primers for Exons 1&2, and CpG island 2. Sequencing PCR products 3. Identifying sequence variants with Sequencher 4. Examine for known SNPs 5. Screening controls with Pyrosequencing

14 CpG Island Primers ATC TCCTAGTTCCTTTGAGCC CGCCAGGTTCCTGGCCGGGCAGTCCGGGGCCGGCGG GCTCACCTGCGTCGGGAGGAAGCGCGGCGGGGCCGG GGCGGGGGTCTCGGCGTTGGGGTCTCTGCGCTGGGG CTCCTGCGCTCCTAGGCGGGTCCTGGGCCGGGCGCC GCCGAGGGGCTCCGAGTCGGGGAGAGGAGCGCGCGG GCGCTGCGGGGCCGCAACACCTGTCTCCCGCCGTGG CGCCTTTTAACCGCACCCCACACCCCGCCTCTTCCC TCGGAGACTGGGAAAGTTACGGAGGGGGCGGCGCCG CGGGCGGAGCGCGCCCGGCCTCTGGGTCCTCAGAGC TTCCCGGGTCCGCGAACCCCCGACCGCCCCCGAAAG CCCCGAACCCCCCAAGTCCCCTTCGAGGTCCCGATC TCCTAGTTCCTTTGAGCC

15 Exon 1 Primers CCCAAGGACGTGTGTTGGTCCAGCCCC AG CGCGGCGGGGCCGGGGCGGGGGTCTCGGCGTTGGGG TCTCTGCGCTGGGGCTCCTGCGCTCCTAGGCGGGTC CTGGGCCGGGCGCCGCCGAGGGGCTCCGAGTCGGGG AGAGGAGCGCGCGGGCGCTGCGGGGCCGCAACACCT GTCTCCCGCCGTGGCGCCTTTTAACCGCACCCCACA CCCCGCCTCTTCCCTCGGAGACTGGGAAAGTTACGG A CCCAAGGACGTGTGTTGGTCCAGCCCCCCGGTTCCC CGAGACCCACGCGGCCGGGCAACCGCTCTGGGTCTC GCGGTCCCTCCCCGCGCCAGGTTCCTGGCCGGGCAG TCCGGGGCCGGCGGGCTCACCTGCGTCGGGAGGAAG CGCGGCGGGGCCGGGGCGGGGGTCTCGGCGTTGGGG TCTCTGCGCTGGGGCTCCTGCGCTCCTAGGCGGGTC CTGGGCCGGGCGCCGCCGAGGGGCTCCGAGTCGGGG AGAGGAGCGCGCGGGCGCTGCGGGGCCGCAACACCT GTCTCCCGCCGTGGCGCCTTTTAACCGCACCCCACA CCCCGCCTCTTCCCTCGGAGACTGGGAAAGTTACGG A

16 TTATTATAGAGATTATATTTTAATGTTTTAAATGTATTTGATACATTACAAAATTATTTTAGTTACAAGCATATCATTAAAGCTATTCTTTATTATTACAAAATGCTTTTACAATGCTATTCTTGACAACAGGAAAATACTTACCCTCACTGAAATATGTGGAGTACCATTTTTTGGAAACCATGTCAAGCATAATGGCAATATTCAGGTTCAATCTTCCTATAGATCTGCTCAATATTTATCTAAACCTTAGCTTCTATTCTTTTCACATGTTATTAGCTATATTTTCACTTAAAAAATTGGAGGCTGAAGGGGTAAGCAAACAAACTTTTGAAGTAGACAAAGCTCATCTTTAATCAACAGACTTTAGAGTCCAGTCTTTCCAAATCTGTTTTTAACGACAGAAACTTCTCCCTCCCCTGCCCCATTTTGTCCTCCCCATTAAATGGTACTGTGTCAATAAAATTCCCAAGCGACCTCTTTAAATCAGCGTTCTTTCCGATGCTGGCTACCACAGTCATGGAAAAGGAGATGTGTTGGACAGGCCTGTCATTACAGGTAGTAGTTGGTGGTACATCCAGTCTGTATTTCTTACACAAAATTACATCTAAATATTTGACATGAGGCCATTTGCTATCATAAGCCATCACTAGGAACTTCTAGTCTGTCTCACTCGATTGAGGCTACAATGTTGTTAGGTGCTATGACCACAATGAATACAACAGACAGCCTCTCAGCTGTGCTGCAAAGTATTCATAACCAAAAGACCATATTTCAAATTAAATCATAGTAGCGAATGACATACCATTTACATATTACAATCTGAGCCTCTGAAACAGGGGGAACATATAATGGTATCCAGAACATCTTTACATCAAAATAACCTATCATACTACAAAGTTTTCACTTCCAAAAAGTGTAACAGAGTTTAAGGCACTGGTAACTTTGTCCACTGTTAGAGATTAAAACTTCCAAAGCAAATGAAAGAACCAATGTTCACCTTTAACGTGGGGAAAGTTGGCAAAAAGAACCCCAGGAGGACACCCAAACCTTCTCTGTGTCCTCTGTGGAACCTGGCTTTTTTCTCTTGTCCTCAGAGAAAGAAACAAATGCCGATATCCTCTGTTTAAAATATGAAAGTACCTTACACCAATAACCCCTAACAGCCTGGGGTCTCAGTGGAACTAACTTAAGTGAAAGAAAATTAAGACAGGCATAGAATTAGGCCTTTGTTTTGAGGCTTTAGGGGAGCAGAGCTCCATTGTGGCATCTGGAGTTTCACCTGAGGC Exon 2 Coding Region Primers CTACAGGGGTTTCAAATGGTTGC TAAACTGGCTTTT TTGACTTCCCAGAACAATATCTAATTAGCAAATAACACAATTCAGTGACATTCAGCAGGATGCAA ATTCCAGACACTGCAATCATGAACACTGTGAAGACAGTCTTCTCCGTGGGCCGGGACACAAAGC AGTCCACAGTGTTGGGACAAGGCCAGGCGTTGCACTTCACCAGCCGCTGCATGGAGAAGCCGTC GTACATGACATAGAAGACGTACATGAAGGCGGCTTCGAAGATGACCCGGAAGAAGATGCTGCTT GTGTAGGTCCACCACAGGGAGCCTTCGATGCGGACCTTCTGGGTTTTGATCTCCTCGATGTCCT TAAATTCACTCTTTATCTCCCCCTTGATGAACTTCCTCTTCTTCTCATGTCTCCGGTAGGCCACG TGCATGGCCACTAGGAGCGCTGGCGTGGACACGAAGATCAGCTGCAGGGCCCATAGCCGGATGT GGGAGATGGGGAAGTAGTGATCGTAGCACACGTTCTTGCAGCCTGGCTGCAGGGTGTTGCAGA CAAAGTCGGCCTGCTCATCTCCCCACACCTCCTTTGCAGCCACAACGAGGATCATAATGCGAAA AATGAAGAGGACGGTGAGCCAGATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCCCAGG ATCGTCTGCAGCGTGCCCCAATCCAT CTTCTCTGAGTCTGGGTAAGC ____________________________________________________ CTACAGGGGTTTCAAATGGTTGCA TTTAAGGTCAGAATCTTTGTGTTGGGAAATGCTAGCGACTGAGCCTTGACAGCTGAGCACGGGTT GCCTCATCCCTCTCATGCTGTCTATTTCTTAATCTAACAACTGGGCAATGCGTTAAACTGGCTTTT TTGACTTCCCAGAACAATATCTAATTAGCAAATAACACAATTCAGTGACATTCAGCAGGATGCAA ATTCCAGACACTGCAATCATGAACACTGTGAAGACAGTCTTCTCCGTGGGCCGGGACACAAAGC AGTCCACAGTGTTGGGACAAGGCCAGGCGTTGCACTTCACCAGCCGCTGCATGGAGAAGCCGTC GTACATGACATAGAAGACGTACATGAAGGCGGCTTCGAAGATGACCCGGAAGAAGATGCTGCTT GTGTAGGTCCACCACAGGGAGCCTTCGATGCGGACCTTCTGGGTTTTGATCTCCTCGATGTCCT TAAATTCACTCTTTATCTCCCCCTTGATGAACTTCCTCTTCTTCTCATGTCTCCGGTAGGCCACG TGCATGGCCACTAGGAGCGCTGGCGTGGACACGAAGATCAGCTGCAGGGCCCATAGCCGGATGT GGGAGATGGGGAAGTAGTGATCGTAGCACACGTTCTTGCAGCCTGGCTGCAGGGTGTTGCAGA CAAAGTCGGCCTGCTCATCTCCCCACACCTCCTTTGCAGCCACAACGAGGATCATAATGCGAAA AATGAAGAGGACGGTGAGCCAGATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCCCAGG ATCGTCTGCAGCGTGCCCCAATCCATCTTCTACTCTGGGCGGTTTGCTCTGGAAAAGACGAATGC ACACAACACAGGAATCACTAGCTAGGACAGAACAGGGAGACTTCTCTGAGTCTGGGTAAGC

17 35delG 167delT C-34T variant G79A polymorphism Patient with a C-34T variant and a G79A polymorphism. Is there significance to these changes when they co-occur? 35delG and 167delT compound heterozygote of mixed Jewish, Italian and Irish decent. Deletion alters chromatogram alignment, which is corrected with the deletion on the opposite chromosome. Both 35delG and 167delT lead to frameshift mutations. C-34T variant

18 Patient from consanguineous Dominican family with a G139T homozygous mutation, leading to substitution of Valine for Glutamine at amino acid 47, initiating a premature STOP. 35delG leads to a frameshift mutation, as seen on this chromatogram. Start Codon G139T homozygous 35delG 35delG common mutation in Caucasian population, found in two Puerto Rican patients and one of mixed Italian, Irish and Jewish decent.

19

20 Schematic of Connexin 26 domains with mutations and polymorphisms included Mutations, polymorphisms and variants exhibited in our study are circled Green Mutations are shown in Green Purple Polymorphisms are shown in Purple Orange Variants of unknown significance are shown in Orange Also seen in our study were 9 patients with C-34T, in the 5UTR, not previously described We noted sequence variations at nucleotide 765, with 65/35 C/T u.ac.jp/deafgene%25/nonsyndromic/ohtsuka.gif K224Q K168R V27I R127H Extracellular Domain Transmembrane Domain Intracellular Domain

21 HE= Heterozygote

22 HO= Homozygote

23 Results one Dominican patient was homozygous for a mutation in GJB2 (G139T)one Dominican patient was homozygous for a mutation in GJB2 (G139T) GJB2 mutations occur in 1/33 European controls (35delG in 2-4%)GJB2 mutations occur in 1/33 European controls (35delG in 2-4%) only one Hispanic 35delG carrier in our controls; all other nucleotide changes were polymorphisms or novel variantsonly one Hispanic 35delG carrier in our controls; all other nucleotide changes were polymorphisms or novel variants

24 Conclusions GJB2 mutations occur less frequently in our minority populationGJB2 mutations occur less frequently in our minority population lower carrier frequencies may account for the lower rate of homozygous individuals in our populationlower carrier frequencies may account for the lower rate of homozygous individuals in our population possible synergistic interaction of heterozygous GJB2 mutations and a mutation in another gene such as GJB6possible synergistic interaction of heterozygous GJB2 mutations and a mutation in another gene such as GJB6

25 Future studies Patient recruitment Patient recruitment JMC NICU and nursery JMC NICU and nursery JMC audiology clinic JMC audiology clinic CHAM Craniofacial Center CHAM Craniofacial Center Controls Controls Hope for: Hope for: 50 cases/year controls/year 50 cases/year controls/year

26 Future Directions Cx30 Cx30 Adjacent to GJB2 Adjacent to GJB2 Mutations are rare Mutations are rare May lead to AD late onset deafness May lead to AD late onset deafness Deletions Deletions Homozygous deafness Homozygous deafness Heterozygous in trans with GJB2 mutation deafness Heterozygous in trans with GJB2 mutation deafness

27 Future Directions SLC26A4 SLC26A4 Encodes monovalent and divalent anion transporter related proteins (Pendrin) Encodes monovalent and divalent anion transporter related proteins (Pendrin) Involved in fluid homeostasis Involved in fluid homeostasis Mutations cause Pendred syndrome (AR; defects of thyroid, kidney and inner ear) Mutations cause Pendred syndrome (AR; defects of thyroid, kidney and inner ear) Often also see Enlarged Vestibular Aqueduct (EVA) or Mondini dysplasia Often also see Enlarged Vestibular Aqueduct (EVA) or Mondini dysplasia

28 Reference List For more information on this topic, see the following publications: Marazita ML, et al., (1993) Genetic epidemiologic studies of early-onset deafness in the U.S. school-age population. Am J Med Genet 46: ). Kelsell DP, et al., (1997) Connexin 26 mutations in hereditary non-syndromal sensoineural deafness. Nature 387(6628): Morton, C (2002) Genetics, genomics and gene discovery in the auditory system. Human Molecular Genetics 11(10): Rabionet R, et al., (2002) Connexin mutations in hearing loss, dermatological and neurological disorders. Trends in Mol Med 8(5): ). Pandya, A, et al., (2003) Frequency and distribution of GJB2 (connexin 26) and GJB6 (connexin 30) mutations in a large North American repository of deaf probands. Genet Med 5(4): Additional information may be found at:


Download ppt "Distributions of Mutations Associated with Sensorineural Hearing Loss 2006 National EHDI Conference Alan Shanske, M.D., FAAP, FACMG Center for Craniofacial."

Similar presentations


Ads by Google