1. Howard Hughes Medical Institute-NMSU Research Scholar
Microsatellite Identification in the Thick-billed Parrot (Rhynchopsitta pachyrhyncha)
By:
Daniel Acosta
Howard Hughes Medical Institute-NMSU Research Scholar
Dr. Wright’s Lab
Department of Biology

2. Thick-billed Parrot
International Union for Conservation of Nature (IUCN 2007)
World Parrot Trust
Historic range: Southwestern United States and Northern Mexico (Snyder et. al., 1999)
Habitat degradation and fragmentation from logging

3. Range

4. Genetic Variation
High degree of genetic variation to reduce the impact of founder effect, which may lead to genetic differentiation
To adapt to a changing environment and to avoid reduced reproductive fitness.
Importance to any translocation.

5. Microsatellites
Microsatellites are simple sequence repeats (1-6) base pairs long: e.g. GTGTGTGTGTGT or ACGACGACGACGACGACGACG found in the genome of both prokaryotic and eukaryotic organisms
Found in coding and non-coding regions
They have a high mutation rate and high variability in natural populations.
High degree of polymorphism
All of these characteristics makes microsatellites a class of genetic marker that is highly useful to assess genetic variation.

6. Methods: Isolation of Microsatellites
Boil clone in TE buffer
Genetic Library
DNA Extraction
PCR
T3/T7
T3/T7/GT10
(Kongrit et. al., 2008)
(Zane et. al. 2002)

7. Methods: Primer Design
Sequencing
Primer Design
CCGAGTAGGACAGAGCCTTGGGTGGCATGGTTTAGTGGGAGGTGTCCCTGCCCACGGCATGGGGTTTGGAACTAGATGATCTTAAGGTCCTTTACAGCCCTAACTGTTCTATGATTCTATTGGGTCTCAAGGGTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCATTTTCCTCTTCAGGGTGGA
ATAAGAGCCTTGAATTACAACATTAAACCTTTTAAATGG
Test for amplification in thick-billed parrot DNA
Optimize Primers
Polymorphism

8. Polymorphism Having genetic diversity
Proportion of loci polymorphic: Number of polymorphic loci / total number of loci sampled
We can also calculate allelic diversity: If we have sampled 6 loci and the diversity is as follows (1, 3, 3, 2, 2, 3) Allelic diversity=( ) / 6 = 2
These calculations tell us a great deal about the genetic variation of the target population

9. Progress and Future Goals
Up to date: 3 primers we designed and 4 designed for other species.
These primers have been optimized for [Mg] and annealing temperature.
We now propose to use these primers to assess the genetic variation not only of the wild population, but of the captive population.
Compare wild population to captive population

10. Acknowledgements Howard Hughes Medical Institute-NMSU Research Program
Dr. Timothy Wright
Ph. D Student Erin Schirtzinger
Ph. D Student Swati Mukherjee
Ph. D Student Alejandro Salinas
Nadine San Diego Zoo
Kari L. American Museum of Natural History

11. References
IUCN Rhynchopsitta pachyrhyncha. < (March 26, ).
Kongrit, C. et. at. (2008). Isolation and characterization of dinucleotide
microsatellite loci in the Asian elephant (Elephas maximus). Molecular
Ecology 8,
Snyder, N. F. R., E. C. Enkerlin-Hoeflich, and M. A. Cruz-Neto Thick-billed Parrot (Rhynchopsitta pachyrhyncha) The Birds of North America 24
Zane, L., Bargelloni, L., & Patarnello, T. (2002). Strategies for microsatellite
isolation: a review. Molecular Ecology 11, 1-16g

12. Picture Sources
(map)

13. Questions??