1. Micropipette Tutorial From the Science Dept at SHS
2 7 8
Micropipette Tutorial
From the Science Dept at SHS

2. 1 μL = 1/1000 of a mL (milliliter) 1 mL = 1/1000 of a L (Liter) So…
2 7 8 μL
This is a Micropipette it is used to accurately transfer small quantities of liquid.
On this model the desired volume can be adjusted within the range of microliters (μL).
1 μL = 1/1000 of a mL (milliliter)
1 mL = 1/1000 of a L (Liter)
So…
1 μL = 1/1,000,000 of a Liter

3. Some Micropipettes have preset volumes and cannot be adjusted.
This pipette will only deliver 200μL.
Out Micropipettes can be adjusted.
Several different ranges
0.5 to 10 uL
2 to 20 uL
20 to 200 uL
200 to 1000 uL
NEVER set the micropipette above or below its intended volume range
200 μL

4. How does it work?
It works much like a syringe that would deliver an injection.
Inside there is a spring loaded piston that moves up and down.
They are very
FRAGILE,
EXPENSIVE,
& COOL!
Be careful!!
2 7 8

5. 2 7 8 The plunger has two stops:
- at the First Stop the piston moves through the volume that is set on the pipette. (In this case 278μL)
2 7 8
278μL
2 7 8

6. The second stop is extra travel used for certain circumstances like evacuating the tip, or drawing up more than the volume indicated on the pipette
2 7 8
278μL
- Extra volume (? μL)
2 7 8

7. - Find all three positions.
2 7 8
2 7 8

8. Setting Volume
2 7 8
Set the correct volume on your micropipette by turning the adjustment knob which is typically the plunger button or a dial on the top portion.
This pipette’s range is μL and is set to deliver 278μL

9. Setting Volume
20-100
2 7 8
Settings can vary between models and manufacturer s.
This pipette’s range is μL and is set to deliver 27.8μL
However you might see the following readings for this exact setting on different pipettes:
2 7 8
The first two make the decimal places obvious,
while the last one implies the tenths place if you know the range.
2 7 8

10. Setting Volume Settings can vary between models and manufacturer s.
2 7 8
Settings can vary between models and manufacturer s.
This pipette’s range is 1-10 μL and is set to deliver 2.78μL
However you might see the following readings for this exact setting on different pipettes:
2 7 8
2 .7 8
2 7 8
Some companies will change the color of the plunger button.

11. Attaching tip
Be sure to choose the proper size tip. Instructors will set these up for you.

12. Attaching tip
2 7 8
Press the pipette into the tip firmly to create an airtight seal.

13. Obtaining a Sample STEP ONE – press plunger to first stop and hold.
2 7 8
HOLD

14. Obtaining a Sample
STEP TWO – Insert tip into sample only far enough to ensure it stays submerged but not to the bottom where it will get blocked
2 7 8
HOLD
KEEP the pipette VERTICAL at all times

15. Obtaining a Sample KEEP the pipette VERTICAL at all times
STEP THREE – Allow plunger to return to the home position SLOWLY so you don’t draw in air bubbles, or splash sample up into tip or the pipette itself.
2 7 8
KEEP the pipette VERTICAL at all times

16. Obtaining a Sample
CORRECT
Removed tip from sample before the plunger was all the way home
Likely allowed the plunger to move to home too quickly.

17. Delivering the Sample KEEP the pipette VERTICAL at all times
STEP FOUR – insert tip into the area you wish to deliver your sample. (in this case a gel for DNA fingerprinting)
2 7 8
KEEP the pipette VERTICAL at all times

18. Delivering the Sample KEEP the pipette VERTICAL at all times
2 7 8
STEP FIVE – depress the plunger slowly to the first stop, then continue to the second stop, this will evacuate the entire contents of the tip. And HOLD
HOLD
KEEP the pipette VERTICAL at all times

19. Delivering the Sample KEEP the pipette VERTICAL at all times
STEP SIX – While still holding the plunger at the second stop. Withdraw the tip from the well.
2 7 8
HOLD
KEEP the pipette VERTICAL at all times

20. Delivering the Sample KEEP the pipette VERTICAL at all times
2 7 8
STEP SEVEN – Allow the plunger to return home.
KEEP the pipette VERTICAL at all times

21. Discarding the Tip WASTE KEEP the pipette VERTICAL at all times
2 7 8
STEP EIGHT – Place tip into the opening of the waste container, then depress the tip ejector.
Tip Ejector
Be sure to use a new tip each time.
WASTE
KEEP the pipette VERTICAL at all times

22. Things to AVOID !!
278
Never use a pipette in anything but a vertical orientation.

23. Things to AVOID !!
278
Never use a pipette without a tip.

24. HAPPY PIPETTING

25. Biotechnology
Gel Electrophoresis

26. Comparing cut up DNA How do we compare DNA from different organisms?
cut up DNA into fragment
Restriction enzymes
separate fragments by size
How do we separate DNA fragments?
run it through a gelatin
gel electrophoresis
How does a gel work?

27. Gel electrophoresis – +
A method of separating DNA in a gelatin-like material using an electrical field
DNA is negatively charged
when it’s in an electrical field it moves toward the positive side
DNA        – +
“swimming through Jello”

28. Gel electrophoresis – + DNA moves in an electrical field…
so how does that help you compare DNA fragments?
size of DNA fragment affects how far it travels
small pieces travel farther
large pieces travel slower & lag behind
DNA        – +
“swimming through Jello”

29. How does it work The gel is made from agarose which is from seaweed
Holes (or wells) are made at one end
The DNA samples are loaded with a micropipette in the wells
The negatively charged DNA moves toward the positive charge electrode: “run to red”

30. Running a gel 1 2 3 fragments of DNA separate out based on size
cut DNA with restriction enzymes 1 2 3
Stain DNA
ethidium bromide binds to DNA
fluoresces under UV light
HS uses a different stain

31. DNA fingerprint Why is each person’s DNA pattern different?
sections of “junk” DNA
doesn’t code for proteins
made up of repeated patterns
CAT, GCC, and others
each person may have different number of repeats
many sites on our 23 chromosomes with different repeat patterns
GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT
CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA
GCTTGTAACGGCATCATCATCATCATCATCCGGCCTACGCTT
CGAACATTGCCGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA

32. DNA patterns for DNA fingerprints
Allele 1
GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT
CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA
repeats
cut sites
Cut the DNA
GCTTGTAACG GCCTCATCATCATCGCCG GCCTACGCTT
CGAACATTGCCG GAGTAGTAGTAGCGGCCG GATGCGAA 1 2 3 –
DNA  +
allele 1

33. Differences between people
Person 1
cut sites
cut sites
GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT
CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA
Person 2: more repeats
GCTTGTAACGGCCTCATCATCATCATCATCATCCGGCCTACGCTT
CGAACATTGCCGGAGTAGTAGTAGTAGTAGTAGGCCGGATGCGAA 1 2 3
DNA fingerprint –
DNA  +
person 1
person 2

34. Uses: Evolutionary relationships
Comparing DNA samples from different organisms to measure evolutionary relationships
turtle
snake
rat
squirrel
fruitfly – 1 3 2 4 5 1 2 3 4 5
DNA  +

35. Uses: Medical diagnostic
Comparing normal allele to disease allele
chromosome with normal allele 1
chromosome with disease-causing allele 2
allele 1
allele 2 –
DNA 
Example: test for Huntington’s disease +

36. Uses: Forensics
Comparing DNA sample from crime scene with suspects & victim
suspects
crime scene sample S1 S2 S3 V –
DNA  +

37. DNA fingerprints
Comparing blood samples on defendant’s clothing to determine if it belongs to victim
DNA fingerprinting

38. Electrophoresis use in forensics
Evidence from murder trial
Do you think suspect is guilty?
blood sample 1 from crime scene
blood sample 2 from crime scene
blood sample 3 from crime scene
“standard”
blood sample from suspect
OJ Simpson
blood sample from victim 1
N Brown
blood sample from victim 2
R Goldman
“standard”

39. Uses: Paternity
Who’s the father? –
Mom F1 F2
child
DNA  +