Presentation is loading. Please wait.

Presentation is loading. Please wait.

MotifML A Novel Ontology-based XML Model for Data- Exchange of Regulatory DNA Motif Profiles Eric Neumann, Beyond Genomics Tian Niu, Harvard University.

Published byCarmel May Modified over 8 years ago

Similar presentations

Presentation on theme: "MotifML A Novel Ontology-based XML Model for Data- Exchange of Regulatory DNA Motif Profiles Eric Neumann, Beyond Genomics Tian Niu, Harvard University."— Presentation transcript:

1 MotifML A Novel Ontology-based XML Model for Data- Exchange of Regulatory DNA Motif Profiles Eric Neumann, Beyond Genomics Tian Niu, Harvard University Ken Baclawski, Northeastern University MotifML A Novel Ontology-based XML Model for Data- Exchange of Regulatory DNA Motif Profiles Eric Neumann, Beyond Genomics Tian Niu, Harvard University Ken Baclawski, Northeastern University

2 ========== = ============ === = ===== === = = ===== == ======= human GCTTGAATTAGACAGGATTAAAGGC TTACTGGAGCTGGAAGCCTTGCCCC -AACTCAGGAGTTTAGCCCCA bovine GCTTGAATTAAATAGGATTAAAGGC TTATCAGGGCTGGGAGCTACACCCC -AACTCCTGAGTTTAGCCCCA mouse GCTTGAATTAGACAGGATTAAAGGC TTAGCAGAGCTGGAAGCCTCACATC TAACTCCCACATTGAGCCCCA | | | | -70 -45 -20 +1 DNA Motifs Alignment Profile Functional Significance? Motifs

3 Motif Finding Tools l AlignACE l GIBBS l Consensus l Propsector

4 l Information resides at multiple sources l Data follow multiple Structures l Multiple Interfaces The Need for motifML BioProspector Gibbs AlignACE Consensus MotifML Integrated XML view

5 l Gene expression regulation that is dependent on activated transcriptional factors l Key element of Gene Networks: Complex analysis of microarrays Motif Function Cis-Elements Associated with a Gene Transcriptional Factors + Regulated Gene Expression

6 motifML Goals l to allow the full specification of all experimental information known about motifs l to provide an extensible framework for this annotation and provide a common vehicle for exchanging the motif information l to provide a single document interface to integrate all project information, complete with protocols for network data retrieval.

7 motifML Design l formal and concise- ontology based l motifML documents easy to create l clarity more important than brevity l use both XML schema and XML DTD

8 motifML Semantics l Annotation »The collection of features for a given set of sequence(s) that have built in semantics l Features »Characteristics supported by analytic evidence l Analyses »Computational »Experimental

9 motifML Semantics Annotation Features Motifs Results Property Intentional Extraction Semantically Definable & Searchable Ontolog y Pragmatic Objects Analyse s

10 GenBank 14588658 CRX Binding Element ATAATGTCCAAGATCTTCTGGAGAGTGTATCCCATGCTGTGGAGCACTCTGTGGAAGCCACGG GTCCTTTAGACAGCTCATCCTATGAGGAGCACTTCTTAACTGGCACTGGTCTCTTGCAGTTTCT GAGAACAAGGCTCTGTGCCATCCCTCGTCTGTTGACTCCCTCTCCACCAGCGCAGCCACGGA GGACCACGTCTCCATGGGAGGATGGGCAGCAAGGAAAGCCCTCAGGGTCATCGAGCATGTGG AGCAAGGTAATGCTGATGAGTTCGGGGTGGCGGGCCTGCCTGATAGACCACTGTGCCTGTGG TTCTCAAGTGGGATCTCCCACCAGCAACATCAGCATC ACCTGGAAAC motifML Sequence Item

11 Computational Analysis <!ELEMENT computational_analysis (date?, program, version?, parameter*, database?, result_set+)> <!ATTLIST seq_relationship seq IDREF #REQUIRED type (query | subject | peer ) #REQUIRED>

12 l Heat shock and other environmental and pathophysiologic stresses stimulate synthesis of heat shock proteins (Hsps). These proteins enable the cell to survive and recover from stressful conditions by as yet incompletely understood mechanisms. l A conserved 14 base pair regulatory sequence, referred to as the heat shock element (HSE), is found in multiple imperfect copies upstream of the TATA box of all heat shock genes. l Genes with an HSE at the upstream region may be co- regulated HSP and HSE

13 Dataset (Vertebrates)* l > gid 3004462, start=1, end=1027 l > gid 7861931, start=1, end=666 l > gid 7108904, start=1, end=1519 l > gid 7739662, start=1, end=800 l > gid 64795, start=1, end=487 l > gid 64791, start=1, end=614 l > gid 64789, start=1, end=1128 l > gid 64786, start=1, end=374 l > gid 32480, start=1, end=483 l > gid 32484, start=1, end=711 l > gid 7669470, start=1, end=424 l > gid 5729878, start=1, end=313 l > gid 5031770, start=1, end=760 l > gid 1816451, start=1, end=2179 l > gid 184422, start=1, end=2634 l > gid 184416, start=1, end=488 l > gid 188491, start=1, end=959 l > gid 4691417, start=1, end=2631 l > gid 188489, start=1, end=485 l > gid 188487, start=1, end=489 l > gid 184416, start=1, end=488 l > gid 211940, start=1, end=391 l > gid 63508, start=1, end=1421 l > gid 63512, start=1, end=2300 l > gid 409185, start=1, end=1231 l > gid 163160, start=1, end=491 l > gid 414974, start=1, end=426 *Data are from GenBank

14 l uses a Gibbs sampling strategy which is similar to that described by Neuwald et al., 1995 l An iterative masking procedure is used to allow multiple distinct motifs to be found within a single data set l Reference: Hughes et al., J Mol Biol. 2000 296:1205-14 AlignACE program

15 AlignACE Results... Motif 1 GGGGAGGGGGTGGGGGGGC 23 788 0 GGCGGGCGGGCGGCGGGGG 23 867 1 GGACAGCGGCGGCTGGCTG 11 107 0 GGGGTGCGGGGGCAGGCGC 23 1417 1 CCGCGGGGGCGGGCGGGGC 13 2034 1... ** * ***** ** *** * MAP Score: 794.004 Motif 2 GGGGAGGGGGTGGGGGGGCGGGG 23 784 0 GTGCGGGGGCAGGCGCGGAGAGC 23 1420 1 GCGGAGCGGGAGGGGGCGTGGCC 13 1932 1 GGGGTGCGGGAGGGCGGGCGGGC 23 1448 1 GGGCAGTGGGCGGCTGGCAGCTG 14 1452 1...

16 l Uses Stochastic Iterative Sampling l The Bernoulli motif sampler assumes that each sequence can contain zero or more ungapped motif elements of each motif type l Reference: »Lawrence et al., Science 1993;262(5131):208-14; »Neuwald et al., Protein Sci. 1995 Aug;4(8):1618-32. Gibbs Motif Sampler Program

17 Gibbs Results... 4, 1 284 agtgc AGAGTCTGGAGAGC cgaat 271 0.87 R gid 7739662, start=1, end=800 4, 2 425 ggtat AGATGTCGGAGAGT cgttt 412 0.79 R gid 7739662, start=1, end=800 4, 3 643 atgga AGCCTCGGGAAACT tcggg 656 0.86 F gid 7739662, start=1, end=800 5, 1 239 atgga AGCCTCGGGAAACT tcggg 252 0.86 F gid 64795, start=1, end=487 7, 1 401 agtgt GGGTGCTGGAGGCT gacgg 388 0.99 R gid 64789, start=1, end=1128 9, 1 26 ggagt GGCGGTGGGAAGGG tgttg 13 0.99 R gid 32480, start=1, end=483... **************...

18 l Uses entropy-based scoring functions l References: »Stormo and Hartzell, PNAS 1989;86:1183-1187 »Hertz et al., 1990, CABIOS, 6:81-92 Consensus Program

19 Consensus Results MATRIX 1... 1|23 : 1/593 TGCAAGATTTTTAA 2|9 : 2/8 TGGAGGCTTCCAGA 3|10 : 3/889 TGGAGGCTTCCAGA... MATRIX 2... 1|23 : 1/593 TGCAAGATTTTTAA 2|9 : 2/8 TGGAGGCTTCCAGA 3|10 : 3/889 TGGAGGCTTCCAGA... MATRIX 3 1|23 : 1/593 TGCAAGATTTTTAA 2|9 : 2/8 TGGAGGCTTCCAGA 3|10 : 3/889 TGGAGGCTTCCAGA... MATRIX 4 1|21 : 1/38 GGGAAAGCTCGAGA 2|9 : 2/8 TGGAGGCTTCCAGA 3|10 : 3/889 TGGAGGCTTCCAGA...

20 l a program that examines the upstream region of genes in the same gene expression pattern group to search for regulatory sequence motifs. l uses zero to third-order Markov background models l allows for the searching of gapped motifs and motifs with palindromic patterns l Reference: Liu et al., Pac Symp Biocomput. 2001:127-38 BioProspector Program

21 BioProspector Results... Motif #1:... Seq #1 seg 1 r998 TCATCCAATCAGAG Seq #2 seg 1 f91 TCAACCGAACAGAA Seq #3 seg 1 r638 TCGACCAATCAAAA... Motif #2:... Seq #1 seg 1 f38 GGGAAAGCTCGAGA Seq #2 seg 1 r648 TGGAAGCCTCCAGT Seq #3 seg 1 r620 TGGAAGCCTCCAGT... Motif #3:... Seq #1 seg 1 r997 CTCATCCAATCAGA Seq #2 seg 1 f90 CTCAACCGAACAGA Seq #3 seg 1 r637 TTCGACCAATCAAA...

22 Conceptions and Interactions of the Underlying Statistical Algorithms Used by the Motif Searching Programs Gibbs AlignACE CONSENSUS Information Content BioProspector Gibbs Sampler; Iterative Updating Strategy Two Block Motif Model

23 Motif Data Representation l Common data representation for motif information. l Uses XML Schema to specify format. l Both human and machine readable. l Supports “knowledge mining”. l Statements can be asserted about a motif such as a role in gene regulation.

24 Example of a motif 0.21 0.59 0.44 0.50 0.06 0.70 0.29... Blk1 A G C T 1 0.00 0.21 0.21 0.59 2 0.00 0.44 0.50 0.06 3 0.70 0.29 0.00 0.00 4 0.32 0.62 0.00 0.06 5 0.03 0.00 0.97 0.00 6 0.00 0.00 1.00 0.00 7 0.85 0.09 0.03 0.03 8 0.88 0.12 0.00 0.00 9 0.03 0.00 0.03 0.94 10 0.03 0.09 0.88 0.00 11 0.70 0.12 0.18 0.00...

25 XML Schema l Extends the XML document type language: »Data format restrictions. »Data value (min and max) restrictions. »Element occurrence (min and max) restrictions. l No sophisticated restrictions: »Probability distribution.

26 XML Schema for MotifML <xsd:element name="block" minOccurs="0" maxOccurs="unbounded" type="BlockType"/>...

27 Statements about motifs <RDF xmlns="http://www.w3.org/1999/02/22-rdf-syntax-ns#” xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#” xmlns:mml="http://www.beyondgenomics.com/2001/07/motifml#" xmlns:bp="http://www.beyondgenomics.com/2001/07/biopathway#"/>

28 l How do biologists learn the element structure of a document describing the heterogeneous sequence alignment output? l How do biologists share the structure and meta-data on motif profiles efficiently and unambiguously? The Need for Bio-Ontologies

29 ========== = ============ === = ===== === = = ===== == ======= human GCTTGAATTAGACAGGATTAAAGGC TTACTGGAGCTGGAAGCCTTGCCCC -AACTCAGGAGTTTAGCCCCA bovine GCTTGAATTAAATAGGATTAAAGGC TTATCAGGGCTGGGAGCTACACCCC -AACTCCTGAGTTTAGCCCCA mouse GCTTGAATTAGACAGGATTAAAGGC TTAGCAGAGCTGGAAGCCTCACATC TAACTCCCACATTGAGCCCCA PCE-I -CBE-- AP-4 8888 cETS cETS | | | | -70 -45 -20 +1 A multiple sequence alignment linked with TRANSFAC/TRANSPATH Shown here is the alignment from -70 to +1. The numbering shown corresponds to the mouse sequence. Identical bases are shown by the = above each nucleotide. Consensus sequence matches conserved among all three species are: the Ret-1/PCE-I element at -65 to -60, the CRX-binding element (CBE) at -55 to -50, an AP-4 consensus core sequence at -37 to -34, a cETS consensus core at -35 to -31 and another at positions -57 to -54, and an S8 homeodomain is shown by "8888" at -64 to -61. Only the core bases are marked. The criteria for searching the TRANSFAC Database by MatInspector were a match to the core sequence of at least 80% and to the entire consensus sequence of at least 85%. The Genbank entries for human, bovine, and mouse are X53044, M32733, and M32734, respectively. (Boatright, Mol Vis 1997; 3:15)X53044M32733M32734 Alignment Profile

30 Transcriptional Factors Ontology Composite Element Site Transcriptional Motif Elements Transcriptional Factors ContextTranscript Tissue Stage Disease Env.Cond. Induced Kind of Part of Binds to Upstream to Within Found in produces Gene Observation contains

31 l Develop a data exchange format for DNA motif data l Handling output from motif analyses l Annotation and data mining of micro-array data l Important in modeling transcriptional regulatory networks in eukaryotes MotifML Applications

32 Future Directions l Distributed Annotation System – Lincoln Stein, Open-Bio l Exchange with Other XML Dialects l DAML development

Download ppt "MotifML A Novel Ontology-based XML Model for Data- Exchange of Regulatory DNA Motif Profiles Eric Neumann, Beyond Genomics Tian Niu, Harvard University."

Similar presentations

Using DAML format for representation and integration of complex gene networks: implications in novel drug discovery K. Baclawski Northeastern University.

Using DAML format for representation and integration of complex gene networks: implications in novel drug discovery K. Baclawski Northeastern University.
Periodic clusters. Non periodic clusters That was only the beginning…

Periodic clusters. Non periodic clusters That was only the beginning…
Blast outputoutput. How to measure the similarity between two sequences Q: which one is a better match to the query ? Query: M A T W L Seq_A: M A T P.

Blast outputoutput. How to measure the similarity between two sequences Q: which one is a better match to the query ? Query: M A T W L Seq_A: M A T P.
Annotation standards in ORegAnno (Draft) Obi Griffith The RegCreative Jamboree Nov 29, 2006 Ghent, Belgium.

Annotation standards in ORegAnno (Draft) Obi Griffith The RegCreative Jamboree Nov 29, 2006 Ghent, Belgium.
PREDetector : Prokaryotic Regulatory Element Detector Samuel Hiard 1, Sébastien Rigali 2, Séverine Colson 2, Raphaël Marée 1 and Louis Wehenkel 1 1 Bioinformatics.

PREDetector : Prokaryotic Regulatory Element Detector Samuel Hiard 1, Sébastien Rigali 2, Séverine Colson 2, Raphaël Marée 1 and Louis Wehenkel 1 1 Bioinformatics.
Computational detection of cis-regulatory modules Stein Aerts, Peter Van Loo, Ger Thijs, Yves Moreau and Bart De Moor Katholieke Universiteit Leuven, Belgium.

Computational detection of cis-regulatory modules Stein Aerts, Peter Van Loo, Ger Thijs, Yves Moreau and Bart De Moor Katholieke Universiteit Leuven, Belgium.
Prof. Carolina Ruiz Computer Science Department Bioinformatics and Computational Biology Program WPI WELCOME TO BCB4003/CS4803 BCB503/CS583 BIOLOGICAL.

Prof. Carolina Ruiz Computer Science Department Bioinformatics and Computational Biology Program WPI WELCOME TO BCB4003/CS4803 BCB503/CS583 BIOLOGICAL.
D ISCOVERING REGULATORY AND SIGNALLING CIRCUITS IN MOLECULAR INTERACTION NETWORK Ideker Bioinformatics 2002 Presented by: Omrit Zemach April 3 2013 Seminar.

D ISCOVERING REGULATORY AND SIGNALLING CIRCUITS IN MOLECULAR INTERACTION NETWORK Ideker Bioinformatics 2002 Presented by: Omrit Zemach April Seminar.
Finding regulatory modules from local alignment - Department of Computer Science & Helsinki Institute of Information Technology HIIT University of Helsinki.

Finding regulatory modules from local alignment - Department of Computer Science & Helsinki Institute of Information Technology HIIT University of Helsinki.
Bioinformatics Motif Detection Revised 27/10/06. Overview Introduction Multiple Alignments Multiple alignment based on HMM Motif Finding –Motif representation.

Bioinformatics Motif Detection Revised 27/10/06. Overview Introduction Multiple Alignments Multiple alignment based on HMM Motif Finding –Motif representation.
Regulatory Motifs. Contents Biology of regulatory motifs Experimental discovery Computational discovery PSSM MEME.

Regulatory Motifs. Contents Biology of regulatory motifs Experimental discovery Computational discovery PSSM MEME.
Bioinformatics Finding signals and motifs in DNA and proteins Expectation Maximization Algorithm MEME The Gibbs sampler Lecture 10.

Bioinformatics Finding signals and motifs in DNA and proteins Expectation Maximization Algorithm MEME The Gibbs sampler Lecture 10.
Identification of a Novel cis-Regulatory Element Involved in the Heat Shock Response in Caenorhabditis elegans Using Microarray Gene Expression and Computational.

Identification of a Novel cis-Regulatory Element Involved in the Heat Shock Response in Caenorhabditis elegans Using Microarray Gene Expression and Computational.
Transcription factor binding motifs (part I) 10/17/07.

Transcription factor binding motifs (part I) 10/17/07.
TRANSFAC Project Roadmap Discussion.  Structure DNA-binding domain (DBD)  The portion (domain) of the transcription factor that binds DNA Trans-activating.

TRANSFAC Project Roadmap Discussion.  Structure DNA-binding domain (DBD)  The portion (domain) of the transcription factor that binds DNA Trans-activating.
Microarrays and Cancer Segal et al. CS 466 Saurabh Sinha.

Microarrays and Cancer Segal et al. CS 466 Saurabh Sinha.
MOPAC: Motif-finding by Preprocessing and Agglomerative Clustering from Microarrays Thomas R. Ioerger 1 Ganesh Rajagopalan 1 Debby Siegele 2 1 Department.

MOPAC: Motif-finding by Preprocessing and Agglomerative Clustering from Microarrays Thomas R. Ioerger 1 Ganesh Rajagopalan 1 Debby Siegele 2 1 Department.
An analysis of “Alignments anchored on genomic landmarks can aid in the identification of regulatory elements” by Kannan Tharakaraman et al. Sarah Aerni.

An analysis of “Alignments anchored on genomic landmarks can aid in the identification of regulatory elements” by Kannan Tharakaraman et al. Sarah Aerni.
Bio277 Lab 3: Finding Transcription Factor Binding Motifs Adapted from a Lab Written by Prof Terry Speed Jess Mar Department of Biostatistics Quackenbush.

Bio277 Lab 3: Finding Transcription Factor Binding Motifs Adapted from a Lab Written by Prof Terry Speed Jess Mar Department of Biostatistics Quackenbush.
Introduction to Bioinformatics - Tutorial no. 5 MEME – Discovering motifs in sequences MAST – Searching for motifs in databanks TRANSFAC – The Transcription.

Introduction to Bioinformatics - Tutorial no. 5 MEME – Discovering motifs in sequences MAST – Searching for motifs in databanks TRANSFAC – The Transcription.

Similar presentations

Ads by Google