Presentation is loading. Please wait.

Presentation is loading. Please wait.

Supplementary file 2. Comparison of highly conserved non-coding PRNP sequences (in bold) between goat (Acc. No. EU870890) and sheep (Acc. No. U67922).

Similar presentations


Presentation on theme: "Supplementary file 2. Comparison of highly conserved non-coding PRNP sequences (in bold) between goat (Acc. No. EU870890) and sheep (Acc. No. U67922)."— Presentation transcript:

1 Supplementary file 2. Comparison of highly conserved non-coding PRNP sequences (in bold) between goat (Acc. No. EU870890) and sheep (Acc. No. U67922). (A) core promoter, (B) exon 1, (C-E) motifs in intron 1 [24], (F) exon 2, (G) a conserved region in intron 2 [24], and (H) a conserved region in the 3-UTR [24]. (A) Goat 5002 GGCAGCGGCTGCGCCTGAGCCTGCGCGCGCCGTCGCCGCCCCGCCCCCGCACCTCCTCCTCCGCCCGGCGACTCACCAGCCCTAGT ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sheep 5580 CGCAGCGGGCGCGCCTGAGCGTGCGCGCGCCGTCGCCTCCCCCCCCCCGCAGCTCCTCCTCTGCACGGCGACTCACCAGCCCTAGT (B) Goat 5088 TGCCAGTTGCTGACAGCCGCAGAGCTGAGAGCGTCTTCTCTCGCAGAGGCAGGT |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sheep 5666 TGCCAGTCGCTGACAGCCGCAGAGCTGAGAGCGTCTTCTCTCCCAGAGGCAGGT (C) Goat 6660 AATGGTGAAATGAAGAATCATTTATGGAATAAAATACAAATCAAAGCAAGTCTGGATTATCGTTTTACAACTACAAGTAAA ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sheep 7242 AATGGTGAAATGAAGAATCATTTATGGAATAAAATACAAATCAAAGCAAGTCTGGATTATCGTTTTACAACTACTAGTAAA (D) Goat 7048 CCTTTAAGCCATGACCCTGAAACCCCACTCCTGGGAACTTACCTGCA ||||||||||||||||||||||||||||||||||||||||||||||| Sheep 7618 CCTTTAAGCCATGACCCTGAAACCCCACTCCTGGGAACTTACCTGCA (E) Goat 7483 ATTAGTGGTTTAATAATTTGTATACTGTTATTCTGTTAAATAATCCATTCTTAGATTTATCAATTATAGTTTTGTTTTTTTTTTAAG ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sheep 8052 ATTAGTGGTTTAATAATTTATATACTGTTATTCTATTAAATAATCCGTTCTTAGATTTATCAATTATAGTTTGTTTTTTTTTTTAAG (F) Goat 7568 AGGACTTCTGAATATATTTGAAAACTGAACAGTTTCAACCAAGCCGAAGCATCTGTCTTCCCAGAGACACAGATCCAACTTGAGCTGAATCACAGCAGATGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sheep 8137 AGGACTTCTGAATATATTTGAAAACTGAACAGTTTCAACCAAGCTGAAGCATCTGTCTTCCCAGAGACACAGATCCAACTTGAGCTGAATCACAGCAGATGT (G) Goat 7969 TCAACAGACAAAAGGTTTTATGAGGTAACAGTTTTTCTAAGCTGTAGTTTTAACTTACCTATTACATTCTCCCTTTTTTGATCTTATTTCCTTTTCCAAG |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sheep 8536 TCAACAGACAAAAGGTTTTATGAGGTAACAGTTTTTCTAAGCTGTAGTTTTAACTTACGTATTGCATTCTCCCTTTTTAGATCTTATTTCCTTTTCCAAG Goat 8069 GCAACCAGTTTATCAACTGTGAACTGCTACATATGAAACATTCAAAACCTGACTGTGTCTAAAGCTGTGATGGCTACAGCAAAATAATCTTTGAGTGAAT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sheep 8636 GCAACCAGTTTATCAACTGTGAACTGCTACATATGAAACATTCAAAACCTGACTGTGTCTAAAGCTGTGATGGCTACAGCAAAATAATCTTTGAGTGAAT Goat 8169 AGCATGTTTAGCAGTTCTTCCAGTTGGGAGAATTTTTTCTCAGTTTGTTCATCCTTTCTCTCCTAACCATGTTCTGCTTATTGCTGTTCTACTATTGTGT |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sheep 8736 AGCATGTTTAGCAGTTCTTACAGTTGGGAGAATTTTTTCTCAGTTTGTTCATCCTT-CTCTCCTAACCATGTTCTGCTTATTGCTGTCCTAATATTGTGT Goat 8269 GATCACGTCAAGGGAGGTGTTCCCTTTTATGCAAAACATTATGT |||||||||||||||||||||||||||||||||||||||||||| Sheep 8835 GATCACGTCAAGGGAGGTGTTCCCTTTTATGCAAAACATTATGT (H) Goat AATACGCATGTGCTTATATTTTTTATATTTGTAACTTTGCATGTACTTGTTTTGTGTTAAAAGTTTATAAATATTTAATATCTGACTAAAATTAAACAGGA ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sheep AATACGCATGTGCTTATATTTTTTATATTTGTAACTTTGCATGTACTTGTTTTGTGTTAAAAGTTTATAAATATTTAATATCTGACTAAAATTAAACAGGA


Download ppt "Supplementary file 2. Comparison of highly conserved non-coding PRNP sequences (in bold) between goat (Acc. No. EU870890) and sheep (Acc. No. U67922)."

Similar presentations


Ads by Google