Presentation is loading. Please wait.

Presentation is loading. Please wait.

TIRs ClassITIRs ClassII Avarage identity 0.782 Avarage identity 0.741 Exons ClassIExons ClassII Introns ClassI Introns ClassII 086_H20115_J16069_M12 086_H20-0.9530.628.

Similar presentations


Presentation on theme: "TIRs ClassITIRs ClassII Avarage identity 0.782 Avarage identity 0.741 Exons ClassIExons ClassII Introns ClassI Introns ClassII 086_H20115_J16069_M12 086_H20-0.9530.628."— Presentation transcript:

1 TIRs ClassITIRs ClassII Avarage identity Avarage identity Exons ClassIExons ClassII Introns ClassI Introns ClassII 086_H20115_J16069_M12 086_H _J _M _H20115_J16069_M12 086_H _J _M _G22201_A23007_O13 104_G _A _O _G22201_A23007_O13 104_G _A _O _H20_TIR5 --ATTGTGCCATCATGAAAACTGGGCTTCGCAATTTTGCCATCTCGAAAATGGGATTCGC _H20_TIR3 CAATTGTGCCATTATGAAAATTGGGCTTCATAATTTTGTCATCCCGAAAATAGGATTCGA _J16_TIR5 --ATTCTGCCATTATGAAAACTGGGCTTCGCAATTTTGCCATCCCGTAAATGGGATTCGC 58 *** ****** ******* ******** ******* **** ** **** ******* 086_H20_TIR5 TCGTTTGCCATTCTCAAACGATACGTACCCGCAAATATGCCCTACGAAGAATTTGTCTTC _H20_TIR3 TCGTTTACCATTCTCAAACGATACACACCAGCAAATATGCCCTGGGAAGAATTTGTCTTC _J16_TIR5 CCGTTTGCCATTCTCAAACGATACACACCCGCAAATATGCCCTGTGGAGGATTTGTTGCC 118 ***** ***************** *** ************* * ** ****** * 086_H20_TIR5 AAATTTATTTATTTTTTTGCCATGACATATTTGCCTTCCAGTTTTGCCCCTGGCTTGATT _H20_TIR3 AAATTTAAT--TTTTTTTGCCATGGCATATTTGCCTTCCAATTTTTCCCCTGCCCTGATT _J16_TIR5 AAATTAATT--TTTTTTTACCATGGCAAACTTGCCTTCCCGTTTTGCCCCT-CCCTGATG 175 ***** * * ******* ***** ** * ********* **** ***** * **** 086_H20_TIR5 CCATCTTT---CCT--CT-TCAT TCACCGTCGTTCACGGAGACAGACGACA-C _H20_TIR3 CCATCTTT---CCT--CT-TCAT TCACCGTCGTTCACGGAGACAGATGACA-C _J16_TIR5 CCATCATGGAGCCTTTCAGTCACGGGTGATTCACGGTCGTTCTCTTGGACGGGAGACAGA 235 ***** * *** * *** **** ******* * *** * **** 086_H20_TIR5 AGACGAGAGAGAACGGAGTGACGCCGCTAGGTCAGGCGAGGGAGAGAGGGAAGGGAGATC _H20_TIR3 AGACGAGAGAGAACGGAGCGACGCCGCTAAGTCAGGTGAGGGAGAGAGGGAAGGAAGATC _J16_TIR5 CGACGCTCGTCTTCATA-TGACGTCGCTAGGTCAAGCGAGGAAGAGAGGGAACGGCTCCC 294 **** * * * **** ***** **** * **** ********** * * 086_H20_TIR5 TTGAGGGAAGGGCTCC-CCGCCGCCG---CCGCCGCCGACGATC _H20_TIR3 TGGAGGGTAGGGCTCG-CCGCCTCCGATGCCGCCACCGACGGTC _J16_TIR5 CGCCGCCGCCAGCACCGTCGCCTCCGCCGCCGCCGCCGACGGTC 338 * ** * **** *** ***** ****** ** 201-A23_TIR5 GGTCCCGTCTTTTTTTTTGGCCCCTTTTTG--AAAGATTCTCTCAAATATGCCCCTGGTC A23_TIR3 --TTTTTTTTGTTTTTTTTGCCCCTTTTTTTTAAAGATTCTCTCAAATATGTCCCTGGCC G22_TIR3 -GGTCGGCCGTCTTTTTTAGCCCTTTTTTCG-AAAGATTCTCTCAAATATGTCCCTGGTG O13_TIR5 -CGTCTTTTTTGTTTTTTGGCCCTTTTTTTG-AAAGATTCTCTCAAATAGGCCCCTGACG O13_TIR3 -CGTCTTTTTTGTTTTTTGGCCCTTTTTTTG-AAAGATTCTCTCAAATAGGCCCCTGACG 58 ****** **** ***** ***************** * ***** 201-A23_TIR5 GAAATATTTCAAAAAAAATGAACCTTGATCTTGACGCCACAGTCACCGGCGCCAAGATAT A23_TIR3 GAAATATTTCAAAAAATAG--ACCCTGATCTTGGCGCCATAATCACCGGCGCCAAGATAT G22_TIR3 GAAAGATTTCAAAAAATAG--ATCCTTATCTTGGCGCCATAGTCGTCGACGCCAAGATAT O13_TIR5 GAAAGATTTCAAAAAATGG--ACCCTCAGCTTGGCGCCATGGTCCATGGCGCCAAGCTAC O13_TIR3 GAAAGATTTCAAAAAATGG--ACCCTCAGCTTGGCGCCATGGTCCATGGCGCCAAGCTAC 116 **** *********** * * * * **** ***** ** * ******* ** 201-A23_TIR5 AAGGGCATGACGCCATTCTCACTGACGCCATGGCCCTGCTGGCGTGGCGCT A23_TIR3 AAGGGCATGGCGCCATTCTCACTGGCGTCATGGCCCTGTTGGCGTGGCGCT G22_TIR3 AACGGCATGGCGCCATGGTCACTGGCGCCATGACCCTGCCGTCGTGGCGCT O13_TIR5 AACGTCATGGCGCCATGTATCCTGGCGCCAAGAGGCATCCGACGTGGCTACACGGGGATC O13_TIR3 AACGTCATGGCGCCATGTATCCTGGCGCCAAGAGGCATCCGACGTGGCTCCACGGGAATC 176 ** * **** ****** *** ** ** * * * ****** 201-A23_TIR5 TACGTGG-AAGGGGTCTTGGCGCCACAG ATCTTGGCGCCA A23_TIR3 TACGTGA-AAGGGGTCTTGGCGCCATAG ATCTTGGCGCCAGCCCCATTGGTG G22_TIR3 GACGTGG-CAGGGAGCATGGCGCCATGG ATCTTGGCGCCA O13_TIR5 TACGTGGCGCGTAGGCTTGGCGCCAAGATCCGTAATATCCTGGCGCCA O13_TIR3 TACGTG--GCGTAG-CTTGGTGCCATGG AGCATGGCGCCA ***** * * *** **** * * ******** 201-A23_TIR5 ---AGCCTTGGCGCCACA-TACTCGACGCCAAGC A23_TIR3 TCATGCCTTGGCGCCACAGATCTTGGCGCCAAGC G22_TIR3 ----AGCATGGCGCCATGGATCTTGGCGCCAAGC O13_TIR5 ---AGCCTTGGCGCCACGGATCTTGGCGCCAAGC O13_TIR3 ---AGACTTGGCGCCAAGATCCATGGCGCCAAGC 244 * ******** * * ******** Figure 1S

2 BAC095F04 BAC148J07 BAC115J16 BAC086H20 BAC249C12 * * * * Class III Class I Class IV ds/dn Figure 2S


Download ppt "TIRs ClassITIRs ClassII Avarage identity 0.782 Avarage identity 0.741 Exons ClassIExons ClassII Introns ClassI Introns ClassII 086_H20115_J16069_M12 086_H20-0.9530.628."

Similar presentations


Ads by Google