Presentation is loading. Please wait.

Presentation is loading. Please wait.

ChIP efficiency (%input)

Similar presentations


Presentation on theme: "ChIP efficiency (%input)"— Presentation transcript:

1 ChIP efficiency (%input)
- + 4OHT Prox Primers Dist 0.1 0.15 0.05 ChIP efficiency (%input) mock H2AX - + chr22: chr21: chr6: chr6: AsiSI site A B Chr6 Chr1 Gene density -0.4 0.4 Log2 (H2AX/input) Log2 (mock/input) C 0.2 -0.2 Log2(H2AX/input) 0.1 0.3 -0.1 0.3 Chr6 p11.2 Chr1 q32.1 0.2 0.1 Log2(H2AX/input) -0.1 -0.2 53 MB MB MB 200 MB MB MB MB Figure S1: H2AX distribution on human chromosomes. A, ChIP was performed on AsiSI-ER-U20S cells after 4OHT treatment using an anti-H2AX antibody (black bars) or no antibody (mock, white bars), followed by real time Q-PCR amplification with the indicated primers to assess H2AX distribution. A representative experiment is shown. B, Global H2AX (black, top) and mock (dark grey, bottom) profiles are shown across chromosomes 1 and 6. Enrichment is expressed as log2 relative to the input, and smoothed using a sliding window of 500 probes. A representative experiment is shown. The low enrichment of H2AX observed by ChIP-chip, is not due to low ChIP efficiency (since we could detect high levels of H2AX when analysing H2AX ChIP by Q-PCR) but reflects a general incorporation of H2AX along chromosome arms (as ChIP-chip experiments do not assess the absolute level of a protein on chromatin, but rather its change in distribution along the genome). Note however that, we can observe a increased presence of H2AX in regions harboring high gene density (light grey, upper panel). C, Detailed view of H2AX distribution across two genomic regions. The pericentromeric region of chr6p (left panel) is depleted in H2AX, whereas the q32.1 cytogenetic band of the chr1 (right panel) is enriched.

2 A B C Figure S2: H2AX is depleted around AsiSI sites.
0.35 0.3 Log2(gH2AX Upstate /input) 0.25 0.15 0.05 0.2 Log2(gH2AX Abcam/input) 0.1 Distance from the AsiSI site (kb) Distance from the AsiSI site (kb) C 0.4 Log2(gH2AX Epitomics /input) 0.3 0.2 0.1 Distance from the AsiSI site (kb) Figure S2: H2AX is depleted around AsiSI sites. A. The log2 gH2AX/input signal (average of two gH2AX ChIP-chips after 4OHT treatment, performed with the Upstate gH2AX antibody) was calculated using a 1000 bp sliding window and is shown over a 20kb window centered on all AsiSI sites contained in gH2AX domains. B. Same as in A except that the log2 gH2AX /input was obtained using a different gH2AX antibody (Abcam ab2893). C. Same as in A except that the log2 gH2AX /input was obtained using a third gH2AX antibody (Epitomics ).

3 Chr 1_6 Chr 6_4 Log2(gH2AX/H2AX) Log2(gH2AX/input) Log2(gH2AX/H2AX) Log2(gH2AX/input) 0.2 0.4 0.6 0.8 Log2 0.8 0.6 Log2 0.4 0.2 0.2 0.4 0.6 0.8 Log2 Chr 1_8 0.2 0.4 0.6 0.8 Log2 Chr 6_5 Log2(gH2AX/H2AX) Log2(gH2AX/input) Log2(gH2AX/H2AX) Log2(gH2AX/input) 0.2 0.4 0.6 0.8 Log2 0.2 0.4 0.6 0.8 Log2 Chr 1_12 Log2(gH2AX/H2AX) Log2(gH2AX/input) Chr 6_7 Log2(gH2AX/H2AX) Log2(gH2AX/input) Figure S3: The H2AX profile is very similar when analyzed over H2AX or input. Detailed views around selected AsiSI sites (indicated by arrows) of the H2AX enrichment over H2AX (in light red) or input (in dark red), expressed as log2 and smoothed using a 500 probe sliding window. ChIP-chip analysis was performed using chromatin from AsiSI-ER-U20S cells treated with 4OHT. A representative experiment (performed with the Upstate gH2AX antibody) is shown. Note the strong similarity between the two profiles.

4 Abcam ab2893 Upstate Chr 1_6 Epitomics Abcam ab2893 1 Upstate Log2(gH2AX/input) 0.6 0.2 Chr 1_8 Chr 1_8 1 0.6 Log2(gH2AX/input) 0.2 Figure S4: The H2AX profile is consistent between three gH2AX antibodies. Detailed views, around selected AsiSI sites (indicated by arrows), of the H2AX enrichment over input obtained with the Upstate gH2AX antibody (in red), with the Abcam gH2AX antibody (in black), or with the Epitomics antibody (in orange) expressed as log2 and smoothed using a 500 probe sliding window. ChIP-chip analyses was performed using chromatin from AsiSI-ER-U20S cells treated with 4OHT. Representative experiments are shown. Note the strong similarity between the three profiles.

5 chr1_6 chr6_7 0.4 0.8 0.4 0.8 U20S U20S 0.4 0.8 Log2 gH2AX/input 0.4 0.8 T98G_G2 Log2 gH2AX/input T98G_G2 0.4 0.8 0.4 0.8 T98G_G1 T98G_G1 chr6_4 0.4 0.8 U20S 0.4 0.8 Log2 gH2AX/input T98G_G2 0.4 0.8 T98G_G1 Figure S5: H2AX profiles are consistent between cell lines and cell cycle phases. Detailed views of H2AX enrichment over input (expressed as log2 and smoothed using a 500 probe sliding window), across several domains of chromosome 1 and 6. ChIP-chip was performed using chromatin from AsiSI-ER-U20S cells (dark red), or AsiSI-ER-T98G in G1 phase (orange), and AsiSI-ER-T98G in G2 phase (red) treated with 4OHT for 4 hours. Representative experiments (performed with the Epitomics antibody) are shown. Arrows indicate AsiSI site positions.

6 A B C gH2AX Abcam gH2AX Upstate gH2AX Epitomics 0.35 0.28 0.3 0.24 0.25 0.25 0.2 Log2(gH2AX Epitomics/input) 0.2 0.15 Log2(gH2AX Upstate/input) 0.16 0.15 Log2(gH2AX Abcam/input) 0.12 0.1 0.05 0.08 0.05 Distance from the TSS (kb) Distance from the TSS (kb) Distance from the TSS (kb) D E H2AX 18 14 10 6 2 0.08 0.25 0.15 0.05 Log2(gH2AX/H3) 0.04 PolII enrichment (ChIP-seq) gH2AX Pol II Log2(H2AX/input) -0.04 Distance from the TSS (kb) Distance from the TSS (kb) Figure S6: Profiles of gH2AX and H2AX across transcription start sites (TSS). A, The 368 genes contained within the gH2AX domains were oriented with respect to transcription start sites (with the transcribed region on the right). The log2 gH2AX/input signal obtained with the gH2AX antibody from Abcam was calculated using a 200 bp sliding window and is shown over a 20kb window centered on the TSS. B, Same as in A, except that the log2 gH2AX/input signal was obtained with the gH2AX antibody from Upstate. C, Same as in A, except that the log2 gH2AX/input signal was obtained with the gH2AX antibody from Epitomics. D, Same as in A, except that the log2 gH2AX/H3 signal is plotted. E, Same as in A, except that the log2 H2AX/input signal is plotted.

7 A 4 2 4 2 Log2(pol II/input) Log2(pol II/input) (+) Strand (+) Strand (-) 4 2 4 2 Log2(pol II/input) Log2(pol II/input) (+) Strand (+) Strand (-) B 0.5 0.4 0.3 0.2 0.1 Log2(pol II/input) Distance to the TSS (kb) Figure S7: Pol II is enriched on genes and at gene promoters. A, Detailed view of PolII binding (in untreated AsiSI-ER-U20S) on selected genes from chromosome 1. Note that PolII can bind over the entire gene locus or can be restricted to the promoter region. B, 3072 genes, located on chromosome 1 and 6, were oriented with respect to transcription (with the transcribed sequence on the right) and the log2 PolII/input signal was calculated using a 200 base sliding window and is shown over a 20kb window centered on the TSS position. Note that, as expected (Barski et al, 2007), PolII is mainly enriched at promoters on a genome wide scale.

8 A B C D Figure S8: gH2AX and Pol II binding are mutually exclusive.
0.05 Pol II -4OHT 1 2 3 4 -1 Log2 (Pol II/ input) 0.02 Log2(Pol II/input) -0.02 -5 +5 Distance from the border (kb) 0.5 1 1.5 Log2(gH2AX/H2AX) C D Mean log2( gH2AX/input) on genes Mean log2( gH2AX/H3) on genes Mean log2( Pol II/input) on genes Mean log2( Pol II/input) on genes Figure S8: gH2AX and Pol II binding are mutually exclusive. A, The 534 “hole” borders previously identified were aligned and overlaid (right and mirror left borders are combined). The white part of the graph corresponds to gH2AX “holes” (as on Figure 6A). The profile of PolII over a 10kb window centered on the hole border and averaged using a 500 base window size is shown. Note that PolII levels are higher in gH2AX holes. B, The log2 (PolII/input) from two independent experiments was averaged, and for each probe encompassed by the previously defined gH2AX domains, the log2 PolII/input (y axis) was plotted against the log2 gH2AX/H2AX (x axis). The probes showing a high value for gH2AX/H2AX have a low value for PolII, and vice versa, indicating that PolII and gH2AX are mutually exclusive. C, The log2 (Pol II/input) (x axis) and log2 (gH2AX /input) (y axis) signals were averaged on each of the 368 genes encompassed in gH2AX domains (from the TSS to the end of the gene), and plotted against each other. Genes showing high Pol II value show low gH2AX level. D, Same as in C, except that the gH2AX/H3 signal is used in y axis.

9 A B Figure S9: High RNA levels and gH2AX are mutually exclusive .
9.77 Distance from the border (kb) Transcription on (-) strand RNA(-) -4OHT 9.82 9.60 9.71 +5 -5 RNA(+) -4OHT Transcription on (+) strand 9.65 9.52 -5 +5 Distance from the border (kb) B Mean log2( gH2AX/H2AX) on genes Mean log2( gH2AX/H3) on genes Mean Log2(gH2AX/input) on genes Mean sense RNA on genes Mean sense RNA on genes Mean Sense RNA on genes Figure S9: High RNA levels and gH2AX are mutually exclusive . A, RNA were extracted from AsiSI-ER-U20S cells (without 4OHT), and reverse transcribed using a protocol that keeps strand information, in order to analyze (+) and (-) strand expression (see Material and Methods). cDNAs were hybridized on the Affymetrix Human Tilling 2.0 A array in order to generate high resolution strand specific expression maps. The 534 borders of gH2AX “holes” previously identified were aligned and overlaid (right and mirror left borders are combined). The profile of the RNA transcribed from the (+) strand (upper panel) and the (-) strand (lower panel), are shown over a 10kb window centered on the hole’s border, and averaged using a 500 base window size. As for PolII binding, RNA levels are increased in gH2AX holes. B, The sense RNA signal for each genes (obtained from the (-) or (+) strand signal depending on gene orientation, see Material and Methods), obtained by the strand specific expression profiling experiment were averaged on each of the 368 genes encompassed in gH2AX domains (from the TSS to the end of the gene). For each of these genes the log2 (gH2AX Upstate/H2AX) (left panel), the lod2 (gH2AX Upstate/H3) (middle panel), or log2 (gH2AX Upstate/input) (right panel) were averaged as well. gH2AX (y axis) and RNA value (x axis) were plotted against each other. As for Pol II binding, the genes showing high expression levels show low gH2AX levels, irrespective of the normalization against H2AX,H3, or input.

10 Figure S10: Cleavage efficiency on AsiSI sites
% of cleveage efficiency Figure S10: Cleavage efficiency on AsiSI sites Genomic DNA was extracted before and after 4OHT treatment and assayed for cleavage at AsiSI sites as described in the Material and Methods section. In these experiments, an AsiSI linearized plasmid was added to each sample before performing ligation, as a normalization control. Pulled down DNA was analyzed by quantitative PCR amplification using primers close to three cleaved AsiSI sites, and two control (uncleaved) sequences. Cleavage efficiency (as a percentage) was calculated relative to the signal obtained with primers located on the AsiSI linearized plasmid. Data shown correspond to the mean and standard deviation from three independent experiments.

11 Mean sense RNA + 4OHT Mean sense RNA – 4OHT Figure S11: Gene Transcription in gH2AX domains is not effected by DSB induction RNA levels were assessed by strand expression profiling with or without 4OHT treatment (see Material and Methods). For each of the 368 genes located within gH2AX domains, sense expression was analyzed by averaging the signal over the gene from either the cDNA1 or cDNA2 array experiments, depending on each gene’s orientation.

12 Figure S12: Model of 3D gH2AX spreading.
transcription factory gH2AX foci gH2AX foci Figure S12: Model of 3D gH2AX spreading. The current model of chromosome organization in the nucleus is based on the existence of clusters of chromatin loops aggregated into 3-dimensional domains (Dorman et al, 2007). Large chromosomal domains may be delimited by elements (depicted in blue) that could therefore block the spreading of gH2AX. Inside gH2AX foci (in red), some loops could be withdraw from the foci, for example to be transcribed in transcription factories (in green), therefore leading to “holes” within the gH2AX domain (as seen when depicted linearly). In addition, some regions distant from the break (but still encompassed in the same large chromosomal domain) may be physically proximal to the break within the nucleus, and therefore covered by gH2AX. This model also explains how the state of gene transcription can be maintained even upon DSB induction and gH2AX focus formation.

13 Table S1: Positions of gH2AX-enriched domains.
4OHT chr Left boundary Right boundary Annotation Score + 1 1667 769796 Telomere 2 AsiSI 3 4 5 6 7 8 9 10 11 Prox AsiSI 12 13 14 15 16 5015 160606 17 18 19 20 21 22 23 24 25 26 27 28 - 737291 153485 Table S1: Positions of gH2AX-enriched domains. Domains were demarcated using the average of gH2AX over H2AX signal from two independent experiments by an in house algorithm (see Materials and Methods). Positions are according to the UCSC hg18 release.

14 symmetry (ratio right/left spreading distance)
Left boundary Right boundary AsiSI position (hg18) Domain size (bp) left spreading (bp) right spreading (bp) symmetry (ratio right/left spreading distance) chr1_1 chr1_2 chr1_3 chr1_4 476384 274792 201592 chr1_5 554152 476669 chr1_6 443932 chr1_7 chr1_8 chr1_9 chr1_10 842946 420890 422056 chr1_11 646115 338646 307469 chr1_12 587535 821608 chr1_13 693087 133815 559272 chr6_1 766953 526394 240559 chr6_2 chr6_3 chr6_4 841731 492983 chr6_5 chr6_6 619227 918487 chr6_7 chr6_8 487069 chr6_9 767909 422008 345901 chr6_10 625732 790406 Table S2: Final set of gH2AX domains used in our analyses. A select set of the previously identified gH2AX domains (Supplementary Table S1) were merged in cases where multiple domains corresponded to a single AsiSI site. These domains were used for the further studies (i.e., “holes” detection, and gH2AX signal across genes). Size and symmetry were however analyzed only for domains that contain a single AsiSI site. Note that domains can be quite asymmetrical relative to the DSB position.

15 Primers used for the Q-PCR
chr22: _dist_FW: CCCATCTCAACCTCCACACT chr22: _dist_REV CTTGTCCAGATTCGCTGTGA chr22: _prox_FW :CCTTCTTTCCCAGTGGTTCA chr22: _prox_REV: GTGGTCTGACCCAGAGTGGT chr22: _dist_FW: TGGCTGGAACTGCTTTCTTT chr22: _dist_REV: GGTGAGTGAATGAGCTGCAA chr22: _prox_FW: ATGCCATGTGTCCTGATGAA chr22: _prox_REV CTGACTGGTGGCTTTTCCAT chr1_6: _FW: GATTGGCTATGGGTGTGGAC chr1_6: _REV CATCCTTGCAAACCAGTCCT chr1_8: _FW CCCTGGAGGTAGGTCTGGT chr1_8: _REV CGCACACTCACTGGTTCCT chr6_12_ _FW TGCCGGTCTCCTAGAAGTTG chr6_12_ _REV GCGCTTGATTTCCCTGAGT chr6: _FW : ACCTGGGATGGGACATATCA chr6: _REV: TACCAAGCCTGTCCCTGAAC chr6: _FW: CAAACACACTCCCCCGTACT  chr6: _REV: CTGGGTTTTCTCCACTGCTG chr1: _FW CGAGATCCAAGGAAGTCGTG chr1: _REV CCCCGGACACTTTAAAAGGA ARV1_FW aaccaggaggccaaagagtt ARV1_REV ccaccacctcaggtatgctt SARS_FW ctggcctgtctacctgcttc SARS_REV ctggcagcatgattcaaaga CELSR2_FW gtgactcaaacccgtgtcct CELSR2_REV ctcacagtatggcccaaggt AMPD2_FW cgtagtgccccgtatgagtt AMPD2_REV cgagtcactgtccgtcttca C6ORF129_FW gaggagaagctgtcccagtg C6ORF129_REV atagacgagcgtcaggagga ZFAND3_FW ggaggaagccatcatgaaaa ZFAND3_REV tggctggctaaagaaaggaa Primers used for the Double Strand oligonucleotide in cleavage assay: FW CGC AAG CTT TAA-TAC-GAC-TCA-CTA-TAG-GG REV Biot-CC CTA TAG TGA GTC GTA TTA AAG CTT GCG AT Table S3: Sequence of primers used for Q-PCR amplification and Cleavage assay


Download ppt "ChIP efficiency (%input)"

Similar presentations


Ads by Google