1. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8 2 0 0.2 0.4 0.6 0.8 1 1.2 1 2 3 AAAAA WT In1m pAm ΔTIn1m ΔTpAm WT In1m pAm ΔTIn1m ΔTpAm Figure S1: Mutation of β-globin intron 1 or the poly(A) signal impairs pre-mRNA processing Chromatin RNA isolated from HeLa cells transfected with the WT, In1m, pAm, ΔTIn1m or ΔTpAm was subjected to reverse transcription and real-time PCR amplification to detect exon 1 spliced to exon 2 (A), exon 2 spliced to exon 3 (B), cleaved and polyadenylated (detected following oligo-dT primed RT) (C), unspliced intron 1(D), unspliced intron 2 (E) and transcriptional read-through (F). Compared to WT, the intron 1 mutations abolished exon 1-exon 2 splicing, inhibited exon 2-exon 3 splicing and cleavage and polyadenylation and increased the level of unspliced introns 1 and 2. The poly(A) site mutations had no effect on exon 1-exon 2 splicing, reduced exon 2- exon 3 splicing and cleavage and polyadenylation and caused, respectively mild and strong accumulation of unspliced introns 1 and 2 Deletion of the terminator element or mutation of the poly(A) site increased transcriptional read-through. In each case, all values are quantitated to WT, which was given a value of 1. Error bars show S.D. from three biological repeats. Relative RNA level A B C D E F Supplementary Figure 1 Relative RNA level 0 1 2 3 4 5 6 2 3 WT In1m pAm ΔTIn1m ΔTpAm Relative RNA level 0 1 2 3 4 5 6 7 1 2 WT In1m pAm ΔTIn1m ΔTpAm Relative RNA level 0 0.2 0.4 0.6 0.8 1 1.2 2 3 WT In1m pAm Relative RNA level ΔTpAm ΔTIn1m 0 1 2 3 4 5 6 1 WT In1m pAm ΔTIn1m ΔTpAm Relative RNA level

2. 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 Chromatin Nucleoplasm Relative E1E2 level Figure S2: Analysis of spliced β-globin exon 1-exon 2 levels in chromatin and nucleoplasmic RNA fractions isolated from cells transfected with WT, pAm and ΔTpAm. In1m and ΔTIn1m samples were not analysed as this species does not accumulate in them. Levels of this species were similar in all chromatin samples. However, although WT transcripts were efficiently released, very little pAm or ΔTpAm transcripts spliced between exons 1 and 2 were released. This result suggests that poly(A) site mutations prevent the nucleoplasmic accumulation of RNA even if a successful splicing event has occurred. The diagram shows the positions of primers used in this experiment. Graph shows the average of two biological replicates where all values are normalised to the WT chromatin value, which was set to 1. Error bars show S.D. from three biological repeats. 1 2 Supplementary Figure 2 WT pAm ΔTpAm

3. 0 20 40 60 80 100 120 Relative Dis3 mRNA level Cont siRNA Dis3 siRNA Figure S3 Dis3 is required to degrade some aberrant β-globin transcripts A.Real-time PCR quantitation of Dis3 mRNA levels in cells treated with control or Dis3- specific siRNA. Dis3 mRNA levels are reduced to less than 10% of control levels upon treatment with Dis3 specific siRNA. B.Analysis of chromatin-associated and nucleoplasmic RNA in control and Dis3 depleted cells transfected with WT, In1m, pAm, ΔTIn1m or ΔTpAm. Diagram shows the position of the primers used (to detect exon 3). Graph shows relative RNA level where, for each construct, the value obtained in control cells was set to 1. Dis3 depletion does not affect WT transcript levels and has a minimal effect on ΔTIn1m and ΔTpAm transcripts. However, In1m and pAm transcripts are increased in both nuclear fractions when Dis3 is depleted. C.Analysis of PROMPTS 40-33 and 40-57 RNA in cells treated with control, Rrp6, Dis3 or both Rrp6 and Dis3 siRNAs. The increase in level of this RNA upon Dis3 depletion shows that the level of depletion achieved is sufficient to impair the degradation activity of Dis3 in the cell. The additional stabilisation upon co-depletion of Dis3 and Rrp6 suggests successful depletion of both factors. The data shown represent one of two biological replicates performed. A B Supplementary Figure 3 0 1 2 3 4 5 6 7 8 9 40-33 40-57 Cont siRNA Rrp6 siRNA Dis3 siRNA Rrp6+Dis3 siRNA Relative RNA level C 0 0.5 1 1.5 2 2.5 Chromatin Nucleoplasm Relative RNA level Cont siRNA Dis3 siRNA Cont siRNA Dis3 siRNA 1 2 pA WT In1m pAm ΔTIn1m ΔTpAm 3

4. 0 0.5 1 1.5 2 2.5 Read-through Relative RNA level 1 2 3 pA * Supplementary Figure 4 Figure S4: Real-time PCR quantitation of read-through RNA obtained by NRO using 4 thio-UTP as a label. Control and Xrn2 depleted cells were transfected with the WT construct and RNA reverse transcribed with random hexamers. PCR was performed to detect exon 3 RNA (black arrows) and read-through RNA (grey arrows show amplicon). The ratio of exon 3 and read-through species was calculated in each case and represented as a value of 1 for control cells. Relative to control cells, we detected more than 2-fold more read-through in Xrn2 depleted cells. This was expected due to the known function of Xrn2 in termination. However, importantly, it demonstrates the capability of this assay to detect nascent RNA known to accumulate in the absence of Xrn2. It should be noted that this result closely aligns with previous observations using standard NRO, which showed more read-through signal from this construct upon Xrn2 knock-down (West et al., 2004). Error bars show S.D. from three biological replicates. Cont siRNA Xrn2 siRNA

5. 0 10 20 30 40 50 60 70 80 90 100 P27 GRAMD3 H2AFY PDE8B EFNA5 DAP STEAP4 Percentage of RNA Nucleoplasm Chromatin SSA - + - + - + - + - + - + - + Figure S5. Analysis of intranuclear distribution of RNAs in MeOH and SSA treated cells. P27, GRAMD3, H2AFY, PDE8B, EFNA5, DAP and STEAP4 transcripts were analysed in control (MeOH) and SSA treated samples. Graph shows percentage of RNA in chromatin-associated (black) and nucleoplasmic (white) samples. The use of SSA (+) or not (-) is indicated under the graph. The data shown represent one of two biological replicates performed. Supplementary Figure 5

6. 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 GRAMD3H2AFYPDE8BEFNA5DAPSTEAP4 Relative ratio SSA:MeOH levels Figure S6 Alternative primer pairs analysing RNA stability in mock and Xrn2 depleted cells with or without SSA Real-time PCR analysis of cDNA synthesised from chromatin RNA isolated from MeoH and SSA treated control or Xrn2 depleted cells. Primer pairs were used to detect intron containing transcripts from the 6 genes. These primer pairs were directed against sequences distinct from those used in figures 5 and 6 of the main text (primers are denoted 3in in supplementary table 1). The graph shows quantitation where we established the ratio of product from SSA to MeOH treated cells. This ratio was given the a value of 1 in control cells and values obtained in Xrn2 depleted cells are shown relative to this. A value of greater than 1 indicates SSA dependent intron stabilisation in Xrn2 depleted cells. Error bars show S.D. from three biological replicates. Supplementary Figure 6

7. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 Cont siRNA + MeOH Cont siRNA + SSA hRrp6 siRNA + MeOH hRrp6 siRNA + SSA GRAMD3H2AFYPDE8BEFNA5DAPSTEAP4 Relative intron 1 level Figure S7 The effect of hRrp6 on levels of aberrant RNA in SSA treated cells. Mock treated and hRrp6-depleted cells were treated with MeOH or SSA before isolation of chromatin-associated RNA. The four samples were then subjected to real-time PCR analysis to quantitate the intron-containing transcripts from the six genes. As with Xrn2, hRrp6 depletion did not affect the level of any of the pre-mRNAs in MeOH treated cells. Comparison of SSA treated samples from mock and hRrp6 treated cells, however, revealed little effect of hRrp6 on transcripts that fail to be spliced. These data suggest that hRrp6 plays a less significant role than Xrn2 in degrading endogenous transcripts following splicing inhibition by SSA. Quantitation shows level of each transcript relative to control MeOH treated cells, where the value was set to 1. Error bars show S.D from four biological replicates. Supplementary Figure 7

8. Figure S8: Intron-containing transcripts generated following SSA treatment are not degraded in a translation- dependent manner and SSA-dependent alternative splicing products are not degraded by Xrn2 A.Cells treated with SSA were, for the final 2 hours of the incubation, treated or not with 100ug/ml cycloheximide (CHX). Following cDNA synthesis Intron 1 containing transcripts were detected by real-time PCR. Graph shows quanititation of the experiment where values obtained in SSA and CHX treated cells are expressed relative to levels obtained in SSA treated cells without CHX, which were set to 1. B.Quantitation of Ccna2 RNA levels in control and Xrn2 depleted cells treated or not with SSA. Quantitation of exon 1 containing transcripts is shown where levels observed in MeOH treated cells were set to 1 for both control and Xrn2 depleted cells. The data shown represent one of two biological replicates performed. Supplementary Figure 8 ABAB 0 0.2 0.4 0.6 0.8 1 1.2 GRAMD3H2AFYPDE8BEFNA5DAPSTEAP4 SSA SSA + CHX Relative intron 1 level 0 0.2 0.4 0.6 0.8 1 1.2 Relative Ccna2 exon 1 MeOH SSA Cont siRNA Xrn2 siRNA

9. Cont siRNA + MeOH Cont siRNA + SSA Xrn2 siRNA + MeOH Xrn2 siRNA + SSA Figure S9. ChIP performed with S2 antibody on control or Xrn2 siRNA treated cells, treated or not with SSA. Graph shows relative Pol II IP, which was given a value of 1 for control cells treated with MeOH. Graph shows one of two biological repeats. Supplementary Figure 9 0 0.2 0.4 0.6 0.8 1 1.2 GRAMD3H2AFYPDE8BEFNA5DAPSTEAP4 Relative Pol II IP

10. 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 Relative Xrn2 enrichment Act pA GRAMD3 H2AFY PDE8B EFNA5 DAP STEAP4 Figure S10: ChIP performed with alternative Xrn2 antibody (see Materials and Methods). Graph shows fold enrichment of signal in Xrn2 antibody samples as compared to no antibody controls. Error bars represent S.D from three biological replicates. Supplementary Figure 10 β-globin

11. 0 0.02 0.04 0.06 0.08 0.1 0.12 0.14 0.16 0.18 0.2 GRAMD3H2AFYPDE8BEFNA5DAPSTEAP Supplementary Figure 11 Figure S11. A.Western blotting of cytoplasmic protein as well as protein extracted from double-washed nuclei. Blots were probed with antibodies to Dcp2 or γ-Tubulin – the latter as a control for contamination of nuclear fractions with cytoplasmic protein. B.ChIP performed with alternative Dcp2 antibody to that used in Figure 6 (see Materials and Methods). Graph shows percentage of input DNA that was precipitated by the antibody. The horizontal line represents the % of input obtained from a non-transcribed control region located within chromosome 10. C.As for B but with values expressed as a fold increase in signal in the Dcp2 antibody sample relative to the parallel mock sample. Error bars show S.D obtained from 3 biological replicates. % IP with anti-Dcp2 BCBC Nuc Cyt Dcp2 γ-Tubulin A NTS 0 1 2 3 4 5 6 7 8 9 10 GRAMD3H2AFYPDE8BEFNA5DAPSTEAPNTS Fold over mock IP

12. Primer sequences (5-3) and siRNA target sites ΔTrttgaatccttttctgagggatg ΔTfggaaactattactcaaagggta H2AFY in1fatcagccccagtctcaagtg H2AFY e2rggagcagtttgatccctgaa H2AFY 3infggatacagcctctcctgctg H2AFY 3inrcactaagcacccctgctctc PDE8b e1faccagcgtgaaggtaaatgc PDE8b i1rtgacaacctctccaaaccaa PDE8b 3inftgggcttgtttacaccaaca PDE8b 3inratggtggtcctgcgagatta GRAMD3 i1faggcaaggggttagaatgga GRAMD3 e2rtgcaggctttctttttctcc GRAMD3 3infttgggaaattgctctgtgaa GRAMD3 3inrtgctaattacccggatctga DAP in1fgcacactcacaggttccaga DAP in1rcagtctcactcccagcttcc P27 e1fccggctaactctgaggacac P27 i1ratacgccgaaaagcaagcta DAP 3infctagggttgaggaggcagtg DAP 3inrcactgtgcccagcctatttt STEAP4 in1fctgcacccactaactcgtca STEAP4 in1raggggaacatcacactctgg STEAP4 3infggcctcctgagtagctgaga STEAP4 3inrtcacttgaggccaggagttt EFNA5 in1factgtgaagctggtagagtgcca EFNA5 in1raatggtgccaggtgactgtcctta EFNA5 e2fagagatgggaatgtaaccggc EFNA5 i2rgttcttgcagctgccctacaa TAF7 5agtggatcactctgccaagc TAF7 3cttcgcctcgggtacttaca GAPDH splfctgacttcaacagcgacacc GAPDH splrggtggtccaggggtcttact PDE8b splfgccgagactcagacctgcta PDE8b splrttgcaaagatcagcaaaacc DAP splfcctcccgaagggaaactaga DAP splrccattcctggtcatccttgt GRAMD3 splfgggaagagggagagcaaact GRAMD3 splrttcttctggtctggggagtc H2AFY splfctcaggccgagacaccttg H2AFY splrctggacgtcttggtggactt EFNA5 splfgtgctctggatgtgtgtgttcagc EFNA5 splrgcaggcactgtagccatcaaagttc STEAP4 splfagcgcctctccctcagttat STEAP4 splrtcaatcccagtgatcttcca Beta e1f (for e1-e2)gcaggctgctggtggtcta Beta e2r (for e1-e2)ccttagggttgcccataaca Beta e2fcctggctcacctggacaacct Beta e3fccacaagtatcactaagctcg Beta e3raatccagatgctcaaggccc Beta read-through Fatcctgcataagcagctgctt Beta read-through Rctcaggagtcaggtgcaccat VAfatcttccgtggtctggtg VArcgttgtctgacgtcgcac EPOfaagctgtgacttctccaggtc EPOrtggtttcagttcttgtaaatg CCNA2 e1fctccaagaggaccaggagaa CCNA2 e1rctctgctgctgcgctagac Supplementary Table 1

13. Primer sequences cont.. Dom3Zfctacctcgtccagcaccttc Dom3Zratggtactggcgttgagcat Dcp2fggctaaacccactgtggaaa Dcp2rcagtggttgcctgtgcttta Actin pAftgtcccccaacttgagatgt Actin pAragccacaccacaaagtcaca Prompt 40-33Rctggcctagctaaagtctca Prompt 40-33Ftctgctcctagctctcagtc Prompt 40-57fatgtcaccaagagcaagaat Prompt 40-57ragatcccagtcatctgtcaa NTSfggctaatcctctatgggagtctgtc NTSrccaggtgctcaaggtcaacatc siRNA targets Xrn2gaguacagaugaucauguu Rrp6cauuaaggaucgaaguaaa Dis3agguagaguuguaggaaua Dcp2cacggaaacuucaggauaa

14. Supplementary Materials and Methods Chromatin immunoprecipitation Two confluent 6cm dishes of HeLa cells were cross-linked in 1% formaldehyde for 10 minutes at room temperature. Cross-links were quenched in 125mM glycine, cells rinsed in PBS then collected by centrifugation (500xg for 5 mins). Cells were sonicated in 350μl RIPA buffer (150mM NaCl, 1% NP40, 0.5% DOC, 0.1% SDS, 50mM Tris.Cl pH8, 5mM EDTA pH8) (30s on, 30s off x 7.5mins on high in a bioruptor sonicator). Chromatin was clarified by centrifugation at 13000xg for 10mins and supernatants added to 15μl of protein A/G dynabeads (Invitrogen) pre- incubated with 2μg anti-Pol II (2 hours rotation in 100μl RIPA buffer). No antibody controls were performed in parallel. Following overnight rotation at 4oC, beads were washed 2x in RIPA buffer, 4x in wash buffer (500mM NaCl, 1% NP40, 1% DOC, 100mM Tris.Cl pH8.5) and 2x in RIPA buffer. Immune complexes were eluted in 0.1M NaHCO3/1%SDS (15mins rotation at room temperature). Cross-links were reversed for 5 hours at 65 o C (250mM NaCl and 1μg RNase A). DNA was phenol chloroform extracted and ethanol precipitated. 1/50th was used for each real-time PCR reaction. RNA immunoprecipitation As for ChIP but with the following modifications: following sonication, clarified lysates were incubated for 20 mins at room temperature in the presence of 3μl DNase. A further 2μl DNase was added to the overnight immunoprecipitation reactions to further enrich for protein-RNA interactions. Following washing and elution (performed as for ChIP), samples were treated 2x, each for 1 hour at 37 degrees, with DNase. After phenol chloroform extraction and ethanol precipitation, 1/3rd of each sample was reverse transcribed and 1/20th of each cDNA sample was used for real-time PCR analysis. Nuclear run on Two confluent 6cm dishes of HeLa cells were scraped in PBS and then lysed in NRO lysis buffer (10mM Tris.Cl pH7.5, 10mM NaCl, 2.5mM MgCl2). The lysate was underlayered with 1ml NRO lysis buffer with 10% sucrose and nuclei isolated (500xg for 5mins). Nuclei were resuspended in an equal volume of transcription buffer (40mM Tris.Cl pH7.9, 300mM KCl, 10mM MgCl2, 40% glycerol) supplemented with 1mM rA, C and GTP as well as 100μM 4-thioUTP. Run on was carried out for 10mins at 30 o C and chromatin-associated RNA was isolated as described. RNA was then biotinylated at a final concentration of 100ng/μl using an EZ-link HPDP kit (Pierce) with 90 minute incubation. Following ethanol precipitation, samples were resuspended in 200μl RPB (300mM NaCl, 10mM Tris.Cl pH7.5, 5mM EDTA pH8) and rotated for 15mins at room temperature with 150mg streptavidin paramagnetic beads (Promega). Beads were washed 5x in 4TU wash buffer (100mM Tris.Cl pH7.5, 10mM EDTA pH8, 1M NaCl, 0.1% Tween) and samples eluted in 50μl 0.1M DTT (15 mins at room temperature). RNA was purified by ethanol precipitation and reverse transcribed prior to PCR analysis.

15. Northern Blotting 5-10μg of total or fractionated RNA was dissolved in 3μg of water and incubated for 1 hour at 55 o C with of glyoxal buffer (0.75μl 0.2M NaPO4 pH7, 7.5μl DMSO, 3ul 40% deionised glyoxal). Loading dye was added and then RNA resolved on a 1.5% agarose gel cast in 1xBPTE (10mM PIPES, 20mM Bis-Tris and 1mM EDTA pH8). RNA was transferred to hybond N+ membrane (GE healthcare) overnight in 20x SSC (3M NaCl, 0.3M Na Citrate). RNA was fixed by UV cross-linking and membrane was blocked for 4 hours in blocking solution (6xSSPE (made from 20x (3.6M NaCl, 0.2M NaH2PO4, 20mM EDTA – pH adjusted to 7.4) stock), 10μg/ml tRNA, 0.1%SDS and 5x Denhardts (made from 100x (2% Ficoll 400, 2% polyvinylpyrolidone, 2% BSA) stock). The exon 3 probe was made by PCR amplification of WT using Beta e3f/Betae3r primer pairs in conjunction with DECA prime kit (Ambion) following manufacturers instructions. The probe was added directly to the blotting solution and left to hybridise overnight at 37 o C. The membrane was washed 2x in 1x SSPE, 0.1% SDS. Bands were visualised following exposure to a phosphor screen.