1. DNA technology the study of sequence, expression, and function of a gene
DNA cloning allows researchers to
Compare genes and alleles between individuals
Locate gene expression in a body
Determine the role of a gene in an organism
Several techniques are used to analyze the DNA of genes

2. Gel Electrophoresis and Southern Blotting
One indirect method of rapidly analyzing and comparing genomes is gel electrophoresis
This technique uses a gel as a molecular sieve to separate nucleic acids or proteins by size
A current is applied that causes charged molecules to move through the gel
Molecules are sorted into “bands” by their size

3. Mixture of DNA mol- ecules of different sizes
Fig. 20-9a
TECHNIQUE
Power source
Mixture of DNA mol- ecules of different sizes –
Cathode
Anode +
Gel 1
Power source
Figure 20.9 Gel electrophoresis – +
Longer molecules 2
Shorter molecules

4. Fig. 20-9b
RESULTS
Figure 20.9 Gel electrophoresis

5. Figure 20.9 Gel electrophoresis
TECHNIQUE
Mixture of DNA mol- ecules of different sizes
Power source –
Cathode
Anode +
Gel 1
Power source – +
Longer molecules 2
Shorter molecules
RESULTS
Figure 20.9 Gel electrophoresis

6. In restriction fragment analysis, DNA fragments produced by restriction enzyme digestion of a DNA molecule are sorted by gel electrophoresis
Restriction fragment analysis is useful for comparing two different DNA molecules, such as two alleles for a gene
The procedure is also used to prepare pure samples of individual fragments

7. Fig
Normal -globin allele
Normal allele
Sickle-cell allele
175 bp
201 bp
Large fragment
DdeI
DdeI
DdeI
DdeI
Large fragment
Sickle-cell mutant -globin allele
376 bp
201 bp 175 bp
376 bp
Large fragment
DdeI
Figure Using restriction fragment analysis to distinguish the normal and sickle-cell alleles of the β-globin gene
DdeI
DdeI
(a) DdeI restriction sites in normal and sickle-cell alleles of -globin gene
(b) Electrophoresis of restriction fragments from normal and sickle-cell alleles

8. A technique called Southern blotting combines gel electrophoresis of DNA fragments with nucleic acid hybridization
Specific DNA fragments can be identified by Southern blotting, using labeled probes that hybridize to the DNA immobilized on a “blot” of gel

9. Restriction fragments DNA + restriction enzyme I II III
Fig a
TECHNIQUE
Heavy weight
Restriction fragments
DNA + restriction enzyme
I II III
Nitrocellulose membrane (blot)
Gel
Sponge
I Normal -globin allele
II Sickle-cell allele
III Heterozygote
Paper towels
Alkaline solution
Figure Southern blotting of DNA fragments 1
Preparation of restriction fragments 2
Gel electrophoresis 3
DNA transfer (blotting)

10. Radioactively labeled probe for -globin gene
Fig b
Radioactively labeled probe for -globin gene
Probe base-pairs with fragments
I II III
I II III
Fragment from sickle-cell -globin allele
Film over blot
Figure Southern blotting of DNA fragments
Fragment from normal -globin allele
Nitrocellulose blot 4
Hybridization with radioactive probe 5
Probe detection

11. Fig
TECHNIQUE
Heavy weight
Restriction fragments
DNA + restriction enzyme
I II III
Nitrocellulose membrane (blot)
Gel
Sponge
I Normal -globin allele
II Sickle-cell allele
III Heterozygote
Paper towels
Alkaline solution 1
Preparation of restriction fragments 2
Gel electrophoresis 3
DNA transfer (blotting)
Radioactively labeled probe for -globin gene
Figure Southern blotting of DNA fragments
Probe base-pairs with fragments
I II III
I II III
Fragment from sickle-cell -globin allele
Film over blot
Fragment from normal -globin allele
Nitrocellulose blot 4
Hybridization with radioactive probe 5
Probe detection

12. Animation
Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at

13. DNA Sequencing
Relatively short DNA fragments can be sequenced by the dideoxy chain termination method
Modified nucleotides called dideoxyribonucleotides (ddNTP) attach to synthesized DNA strands of different lengths
Each type of ddNTP is tagged with a distinct fluorescent label that identifies the nucleotide at the end of each DNA fragment
The DNA sequence can be read from the resulting spectrogram

14. Fig a
TECHNIQUE
DNA (template strand)
Primer
Deoxyribonucleotides
Dideoxyribonucleotides (fluorescently tagged)
dATP
ddATP
dCTP
ddCTP
dTTP
DNA polymerase
ddTTP
dGTP
ddGTP
Figure Dideoxy chain termination method for sequencing DNA

15. Direction of movement of strands Longest labeled strand
Fig b
TECHNIQUE
DNA (template strand)
Labeled strands
Shortest
Longest
Direction of movement of strands
Longest labeled strand
Detector
Figure Dideoxy chain termination method for sequencing DNA
Laser
Shortest labeled strand
RESULTS
Last base of longest labeled strand
Last base of shortest labeled strand

16. Figure 20.12 Dideoxy chain termination method for sequencing DNA
TECHNIQUE
DNA (template strand)
Primer
Deoxyribonucleotides
Dideoxyribonucleotides (fluorescently tagged)
dATP
ddATP
dCTP
ddCTP
DNA polymerase
dTTP
ddTTP
dGTP
ddGTP
DNA (template strand)
Labeled strands
Shortest
Longest
Direction of movement of strands
Longest labeled strand
Figure Dideoxy chain termination method for sequencing DNA
Detector
Laser
Shortest labeled strand
RESULTS
Last base of longest labeled strand
Last base of shortest labeled strand

17. Analyzing Gene Expression
Nucleic acid probes can hybridize with mRNAs transcribed from a gene
Probes can be used to identify where or when a gene is transcribed in an organism

18. Studying the Expression of Single Genes
Changes in the expression of a gene during embryonic development can be tested using
Northern blotting
Reverse transcriptase-polymerase chain reaction
Both methods are used to compare mRNA from different developmental stages

19. Northern blotting combines gel electrophoresis of mRNA followed by hybridization with a probe on a membrane
Identification of mRNA at a particular developmental stage suggests protein function at that stage

20. Reverse transcriptase-polymerase chain reaction (RT-PCR) is quicker and more sensitive
Reverse transcriptase is added to mRNA to make cDNA, which serves as a template for PCR amplification of the gene of interest
The products are run on a gel and the mRNA of interest identified

21. TECHNIQUE 1 cDNA synthesis mRNAs cDNAs Primers 2 -globin gene 3
Fig
TECHNIQUE 1
cDNA synthesis
mRNAs
cDNAs
Primers 2
PCR amplification
-globin gene 3
Gel electrophoresis
Figure RT-PCR analysis of expression of single genes
Embryonic stages
RESULTS

22. In situ hybridization uses fluorescent dyes attached to probes to identify the location of specific mRNAs in place in the intact organism

23. Fig
Figure Determining where genes are expressed by in situ hybridization analysis
50 µm

24. Studying the Expression of Interacting Groups of Genes
Automation has allowed scientists to measure expression of thousands of genes at one time using DNA microarray assays
DNA microarray assays compare patterns of gene expression in different tissues, at different times, or under different conditions

25. Labeled cDNA molecules (single strands)
Fig
TECHNIQUE
Tissue sample 1
Isolate mRNA. 2
Make cDNA by reverse transcription, using fluorescently labeled nucleotides.
mRNA molecules
Labeled cDNA molecules (single strands) 3
Apply the cDNA mixture to a microarray, a different gene in each spot. The cDNA hybridizes with any complementary DNA on the microarray.
DNA fragments representing specific genes
Figure DNA microarray assay of gene expression levels
DNA microarray
DNA microarray with 2,400 human genes 4
Rinse off excess cDNA; scan microarray for fluorescence. Each fluorescent spot represents a gene expressed in the tissue sample.

26. Animation
Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at

27. Determining Gene Function
One way to determine function is to disable the gene and observe the consequences
Using in vitro mutagenesis, mutations are introduced into a cloned gene, altering or destroying its function
When the mutated gene is returned to the cell, the normal gene’s function might be determined by examining the mutant’s phenotype

28. Gene expression can also be silenced using RNA interference (RNAi)
Synthetic double-stranded RNA molecules matching the sequence of a particular gene are used to break down or block the gene’s mRNA

29. Medical Applications
Many fields benefit from DNA technology and genetic engineering
One benefit of DNA technology is identification of human genes in which mutation plays a role in genetic diseases

30. Diagnosis of Diseases
Scientists can diagnose many human genetic disorders by using PCR and primers corresponding to cloned disease genes, then sequencing the amplified product to look for the disease-causing mutation
Genetic disorders can also be tested for using genetic markers that are linked to the disease- causing allele

31. Single nucleotide polymorphisms (SNPs) are useful genetic markers
These are single base-pair sites that vary in a population
When a restriction enzyme is added, SNPs result in DNA fragments with different lengths, or restriction fragment length polymorphism (RFLP)

32. Disease-causing allele
Fig
DNA T
Normal allele
SNP C
Figure Single nucleotide polymorphisms (SNPs) as genetic markers for disease-causing alleles
Disease-causing allele

33. Animation
Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at

34. RFLP
acccttta agctgggtgt cccaaatagt ttacttcaat tagtatttag tatcctgctt taaaagccta tccagtattt tcatatctgt tttaatattt agctcttatt tttcaatata ggcctgaagt gttagaagat tcacctctgg ttccccaaaa aggcagtttt cagatggttc actgcaattg cagtgttcat gaatgttgtg aatgtcttgt gcctgtgccaacagccaaac tcaacgacac tctccttatg tgtttgaaaa tcacatctgg tggagtaatt ttccagtcac ctctaatgtc agttcagccc ataaatatgg gtaagttatg cactaaaatg atgataatag gtctaaacat cagtcatata taaaggttaa aaattgctta caaaaatatt tgctagctta
blue – reverse primer anneals here
pink – forward primer anneals here

35. Cut with Msp I at ccgg
Point mutation at the a  g
~ 400 bp band ?
~300 bp band ?

36. Human Gene Therapy
Gene therapy is the alteration of an afflicted individual’s genes
Gene therapy holds great potential for treating disorders traceable to a single defective gene
Vectors are used for delivery of genes into specific types of cells, for example bone marrow
Gene therapy raises ethical questions, such as whether human germ-line cells should be treated to correct the defect in future generations

37. Insert RNA version of normal allele into retrovirus.
Fig
Cloned gene 1
Insert RNA version of normal allele into retrovirus.
Viral RNA 2
Let retrovirus infect bone marrow cells that have been removed from the patient and cultured.
Retrovirus capsid 3
Viral DNA carrying the normal allele inserts into chromosome.
Bone marrow cell from patient
Figure Gene therapy using a retroviral vector
Bone marrow 4
Inject engineered cells into patient.

38. Pharmaceutical Products
Advances in DNA technology and genetic research are important to the development of new drugs to treat diseases

39. Synthesis of Small Molecules for Use as Drugs
The drug imatinib is a small molecule that inhibits overexpression of a specific leukemia-causing receptor
Pharmaceutical products that are proteins can be synthesized on a large scale

40. Protein Production in Cell Cultures
Host cells in culture can be engineered to secrete a protein as it is made
This is useful for the production of insulin, human growth hormones, and vaccines

41. E. coli expression system: pQE-30 Expression Vector (Qiagen, Germany)
Size: 3.4 kb
Promoter: Phage T5
Operator: 2x lac O
Repressor protein: lac R. protein
Origin of Replication: Col E1 ori
RBS: for high translation rate
Marker: Ampr from bla gene
Multiple Cloning Site (MCS):
BamHI, SphI, SacI, KpnI, SmaI, XmaI, SalI, PstI, HindIII
Purification Tag: 6x-His Tag at N-terminal of rec. protein
Purification: Ni-NTA Affinity Chromatography
Host cells for cloning E.coli DH5α
Expression in E.coli M15
The system of choice was that offered by pQE-30 expression vector by Qiagen Germany. The 3.4 kb vector has a strong phage T5 promoter that is regulated by 2 lacO sites that is controlled by the lac repressor protein. It has multiple cloning sites as seen in the figure and selection is based on Ampicillin resistancy conferred by the bla gene.
The unique quality of this expression vector is that the recombinant protein is tagged with 6 his residues and can be purified using the Ni-NTA matrix in either native or denaturing conditions.
Optimized promoter–operator element consisting of phage T5 promoter (recognized
by the E. coli RNA polymerase) and two lac operator sequences which increase lac
repressor binding and ensure efficient repression of the powerful T5 promoter
• Synthetic ribosomal binding site, RBSII, for high translation rates
• 6xHis-tag coding sequence N terminal
• Multiple cloning site and translational stop codons in all reading frames for convenient
preparation of expression constructs
• Two strong transcriptional terminators: t0 from phage lambda (Schwarz et al. 1987),
and T1 from the rrnB operon of E. coli, to prevent read-through transcription and
ensure stability of the expression construct
2 Lac operator Increases efficiency of repressor protein binding and efficient repression of powerful PT5 promoter
NO lac I which limits the expression to M15 and SG13009 E.coli which has pREP4 plasmid.
pREP4 produces repressor protein to repress and regulate PT5 promoter
JM10- can but only storage because there is still lac I
• β-lactamase gene (bla) confers resistance to ampicillin (Sutcliffe 1979) at 100 μg/ml (the
chloramphenicol acetyl transferase gene (CAT) present between t0 and T1 is not expressed)
• ColE1 origin of replication (Sutcliffe 1979)
[Adapted from The QIAexpressionist 2003]

42. 2L Bioreactor

43. Protein Production by “Pharm” Animals and Plants
Transgenic animals are made by introducing genes from one species into the genome of another animal
Transgenic animals are pharmaceutical “factories,” producers of large amounts of otherwise rare substances for medical use
“Pharm” plants are also being developed to make human proteins for medical use

44. Fig
Figure Goats as “pharm” animals

45. Forensic Evidence and Genetic Profiles
An individual’s unique DNA sequence, or genetic profile, can be obtained by analysis of tissue or body fluids
Genetic profiles can be used to provide evidence in criminal and paternity cases and to identify human remains
Genetic profiles can be analyzed using RFLP analysis by Southern blotting

46. Even more sensitive is the use of genetic markers called short tandem repeats (STRs), which are variations in the number of repeats of specific DNA sequences
PCR and gel electrophoresis are used to amplify and then identify STRs of different lengths
The probability that two people who are not identical twins have the same STR markers is exceptionally small

47. Fig
(a)
This photo shows Earl Washington just before his release in 2001, after 17 years in prison.
Source of sample
STR marker 1
STR marker 2
STR marker 3
Figure STR analysis used to release an innocent man from prison
For the Discovery Video DNA Forensics, go to Animation and Video Files.
Semen on victim
17, 19
13, 16
12, 12
Earl Washington
16, 18
14, 15
11, 12
Kenneth Tinsley
17, 19
13, 16
12, 12
(b)
These and other STR data exonerated Washington and led Tinsley to plead guilty to the murder.

48. Please note that due to differing operating systems, some animations will not appear until the presentation is viewed in Presentation Mode (Slide Show view). You may see blank slides in the “Normal” or “Slide Sorter” views. All animations will appear after viewing in Presentation Mode and playing each animation. Most animations will require the latest version of the Flash Player, which is available at

49. Environmental Cleanup
Genetic engineering can be used to modify the metabolism of microorganisms
Some modified microorganisms can be used to extract minerals from the environment or degrade potentially toxic waste materials
Biofuels make use of crops such as corn, soybeans, and cassava to replace fossil fuels

50. Animal Husbandry
DNA technology is being used to improve agricultural productivity and food quality
Genetic engineering of transgenic animals speeds up the selective breeding process
Beneficial genes can be transferred between varieties or species

51. Genetic Engineering in Plants
Agricultural scientists have endowed a number of crop plants with genes for desirable traits
The Ti plasmid is the most commonly used vector for introducing new genes into plant cells
Genetic engineering in plants has been used to transfer many useful genes including those for herbicide resistance, increased resistance to pests, increased resistance to salinity, and improved nutritional value of crops

52. Agrobacterium tumefaciens
Fig
TECHNIQUE
Agrobacterium tumefaciens
Ti plasmid
Site where restriction enzyme cuts
T DNA
RESULTS
DNA with the gene of interest
Figure Using the Ti plasmid to produce transgenic plants
For the Cell Biology Video Pronuclear Injection, go to Animation and Video Files.
For the Discovery Video Transgenics, go to Animation and Video Files.
Recombinant Ti plasmid
Plant with new trait

53. Safety and Ethical Questions Raised by DNA Technology
Potential benefits of genetic engineering must be weighed against potential hazards of creating harmful products or procedures
Guidelines are in place in the United States and other countries to ensure safe practices for recombinant DNA technology

54. Most public concern about possible hazards centers on genetically modified (GM) organisms used as food
Some are concerned about the creation of “super weeds” from the transfer of genes from GM crops to their wild relatives

55. As biotechnology continues to change, so does its use in agriculture, industry, and medicine
National agencies and international organizations strive to set guidelines for safe and ethical practices in the use of biotechnology

56. You should now be able to:
Describe the natural function of restriction enzymes and explain how they are used in recombinant DNA technology
Outline the procedures for cloning a eukaryotic gene in a bacterial plasmid
Define and distinguish between genomic libraries using plasmids, phages, and cDNA
Describe the polymerase chain reaction (PCR) and explain the advantages and limitations of this procedure

57. Explain how gel electrophoresis is used to analyze nucleic acids and to distinguish between two alleles of a gene
Describe and distinguish between the Southern blotting procedure, Northern blotting procedure, and RT-PCR
Distinguish between gene cloning, cell cloning, and organismal cloning

58. Describe the application of DNA technology to the diagnosis of genetic disease, the development of gene therapy, vaccine production, and the development of pharmaceutical products
Define a SNP and explain how it may produce a RFLP
Explain how DNA technology is used in the forensic sciences
Discuss the safety and ethical questions related to recombinant DNA studies and the biotechnology industry

59. One strand of a DNA molecule has the sequence 3′-GGATGCCCTAGGCTTGTT-5′
One strand of a DNA molecule has the sequence 3′-GGATGCCCTAGGCTTGTT-5′. Which of the following is the complementary strand?
3′-AACAAGCCTAGGGCATCC-5′
3′-CCTACGGGATCCGAACAA-5′
5′-AACAAGCCTAGGGCATCC-3′
5′-GGATGCCCTAGGCTTGTT-3′
Answer: a
This question covers information in Concept 20.1 (“Screening a Library for Clones Carrying a Gene of Interest”).
Copyright © 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings.

60. You have a restriction enzyme that makes a blunt cut between an A and a T. What will the size of the DNA fragments be after the following DNA molecule is cut with this restriction enzyme: 5′-TTGTTCGGATCCCGTAGG-3′?
one 9-bp fragment, one 6-bp fragment, and one 3-bp fragment
one 15-bp fragment and one 3-bp fragment
one 18-bp fragment
two 9-bp fragments
Answer: d
This question focuses on Concept 20.1 (“Using Restriction Enzymes to Make Recombinant DNA”—recognize GGATCC as the only restriction site) and Concept 20.2 (“Gel Electrophoresis and Southern Blotting”).
Copyright © 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings.

61. You have isolated this eukaryotic gene and wish to express the protein it codes for in a culture of recombinant bacteria. Will you be able to produce a functioning protein with the gene as is?
Yes
No, the exons will need to be cut out and the introns spliced back together.
No, the introns will need to be cut out and the exons spliced back together.
No, the exons will need to be cut out, the introns translated individually, and the peptides bound together after translation.
Answer: c
Copyright © 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings.

62. This segment of DNA is cut at restriction sites 1 and 2, which creates restriction fragments A, B, and C. Which of the following electrophoretic gels represents the separation of these fragments?
Answer a
Answer b
Answer c
Answer d
Answer: a
This question focuses on Concept 20.2 (“Gel Electrophoresis and Southern Blotting”).
Copyright © 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings.

63. The photograph shows Rainbow and CC (CC is Rainbow’s clone)
The photograph shows Rainbow and CC (CC is Rainbow’s clone). Why is CC’s coat pattern different from Rainbow’s given that CC is genetically identical?
X chromosome inactivation
heterozygous at coat color gene locus
environmental effects on gene expression
all of the above
Answer: d
This question focuses on Concept 20.3 (“Cloning Animals: Nuclear Transplantation”).
Copyright © 2008 Pearson Education, Inc., publishing as Pearson Benjamin Cummings.