Presentation is loading. Please wait.

Presentation is loading. Please wait.

Things that can muck up a DNA Profile The list is long and distinguished... By Christine Funk, with a lot of help from her friends... Board of Public Defense.

Similar presentations


Presentation on theme: "Things that can muck up a DNA Profile The list is long and distinguished... By Christine Funk, with a lot of help from her friends... Board of Public Defense."— Presentation transcript:

1 Things that can muck up a DNA Profile The list is long and distinguished... By Christine Funk, with a lot of help from her friends... Board of Public Defense Trial Team

2 There are many, many ways to muck up a DNA profile Collection Muck Ups -Contamination during collection Interpretation Muck Ups – Mixed Samples Amplification Muck Ups Degradation Primer Binding Muck Ups - Peak Height Imbalance Capillary Muck Ups - Blobs and Noise Dye Muck Ups - Pull Up Spikes DNA Mutation Muck Ups - Tri-allelic Patterns; Off Ladder Alleles Machine Muck Ups - Signal Data Low Level DNA - Allelic Imbalance Interpretation Muck ups – Examiner Bias Math Muck Ups – Fun with Numbers!

3 Lets have a giggle, shall we?

4

5 Collection Muck Ups: Typically, DNA in criminal cases has done a little traveling...

6 Primary Transfer Picture courtesy of Jennifer Friedman

7 Secondary transfer Clipping courtesy of Bob Blaiser

8 Collection muck up

9 8...The match to the bib occurred as a result of contamination in the laboratory and was not an adventitious match..." The Leskie Decision

10 8... The samples from the two cases were examined by the same scientist within a close time frame." The Leskie Decision

11 Mixture Interpretation How does one interpret a mixture, that is, which bands or peaks are alleles and which are artifacts or errors?

12 D5S818 D13S317 D7S820 D8S1179 D21S11 D18S51 Amel VWA FGA D3S1358 blue panel green panel yellow panel Relative Fluorescence Units Sample Mixture Example Profiler Plus data Higher than expected stutter Stutter on wrong side of allele Imbalance in X and Y peak ratios 4 peaks at a single locus

13 Whos in the Mix? Care to take a guess?

14 Whos in here? XY 11, 15 28, 30 12, 15

15 But wait! What if… XY 11, 15 28, 30 12, 15 XY 13, , , 19

16 Whoops! I meant to say… XY 11, 15 28, 30 12, 15 XY 13, , , 19 XY 11, 13 28, , 17

17 Perspective is everything

18 12, 12 12, 13 12, 14 12, 15 12, 16 12, 17 12, 18 12, 19 13, 13 13, 14 13, 15 13, 16 13, 17 13, 18 13, 19 14, 14 14, 15 14, 16 14, 17 14, 18 14, 19 15, 15 15, 16 15, 17 15, 18 15, 19 16, 16 16, 17 16, 18 16, 19 17, 17 17, 18 17, 19 18, 18 18, 19 19, 19 Alleles Present: 13, 17, 18

19 12, 12 12, 13 12, 14 12, 15 12, 16 12, 17 12, 18 12, 19 13, 13 13, 14 13, 15 13, 16 13, 17 13, 18 13, 19 14, 14 14, 15 14, 16 14, 17 14, 18 14, 19 15, 15 15, 16 15, 17 15, 18 15, 19 16, 16 16, 17 16, 18 16, 19 17, 17 17, 18 17, 19 18, 18 18, 19 19, 19 Alleles Present: 13, 17, 18 Possible Contributors to D3: 13, 13; 13, 17; 13,18;17, 17; 17,18; 18,18 SIX possible profiles in D3

20 But Wait!! Theres more... *ladders not to scale

21 11, 11 11, 12 11, 13 11, 14 11, 15 11, 16 11, 17 11, 18 11, 19 11, 20 11, 21 12, 12 12, 13 12, 14 12, 15 12, 16 12, 17 12, 18 12, 19, 12, 20 12, 21 13, 13 13, 14 13, 15 13, 16 13, 17 13, 18 13, 19 13, 20 13, 21 14, 14 14, 15 14, 16 14, 17 14, 18 14, 19 14, 20 14, 21 15, 15 15, 16 15, 17 15, 18 15, 19 15, 20 15, 21 16, 16 16, 17 16, 18 16, 19 16, 20 16, 21 17, 17 17, 18 17, 19 17, 20 17, 21 18, 18 18, 19 18, 20 18, 21 19, 19 19, 20 19, 21 20, 20 20, 2121, 21 Alleles Present: 16, 17, 18, 19

22 11, 11 11, 12 11, 13 11, 14 11, 15 11, 16 11, 17 11, 18 11, 19 11, 20 11, 21 12, 12 12, 13 12, 14 12, 15 12, 16 12, 17 12, 18 12, 19, 12, 20 12, 21 13, 13 13, 14 13, 15 13, 16 13, 17 13, 18 13, 19 13, 20 13, 21 14, 14 14, 15 14, 16 14, 17 14, 18 14, 19 14, 20 14, 21 15, 15 15, 16 15, 17 15, 18 15, 19 15, 20 15, 21 16, 16 16, 17 16, 18 16, 19 16, 20 16, 21 17, 17 17, 18 17, 19 17, 20 17, 21 18, 18 18, 19 18, 20 18, 21 19, 19 19, 20 19, 21 20, 20 20, 2121, 21 Alleles Present: 16, 17, 18, 19 Possible Contributors: 16, 16; 16, 17; 16, 18; 16, 19; 17, 17; 17, 18; 17, 19 Still MORE contributors: 18, 18; 18, 19; 19, 19

23 10!! 10 Possible Profiles in vWA!!!

24 6 profiles from D3 10 profiles from vWA 60 profiles so far. We have 14 loci to go...

25 Why this is hard: You dont know how many people are in the mix You dont know when and where their alleles overlap You dont know if you have alleles that have dropped out due to low copy numbers You dont know if you have a triallelic pattern or stutter or primer binding site mutation

26 Amplification Muck up

27 STR Alleles with Stutter Products D21S11D18S51D8S1179 DNA Size (bp) Stutter Product 6.3%6.2% 5.4% Allele Relative Fluorescence Units

28 Stutter in Pictures – First, lets review how its supposed to happen... GTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCT CAGACAGACAGACAGACAGACAGACAGACAGA

29 Stutter in Pictures – how amplification is supposed to happen GTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCT CAGACAGACAGACAGACAGACAGACAGACAGA

30 Stutter in Pictures: amplification as it should be... GTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCT CAGACAGACAGACAGACAGACAGACAGACAGA GTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCT CAGACAGACAGACAGACAGACAGACAGACAGA

31 Stutter in Pictures – Amplification gone horribly awry... GTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCT CAGACAGACAGACAGACAGACAGACAGACAGA

32 Stutter in Pictures GTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCT C A G A C A G A C A G A C A G A

33 Stutter in Pictures GTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCT C A G A C A G A C A G A C A G A

34 Stutter in Pictures GTCTGTCTGTCTGTCTGTCTGTCT C A G A C A G A C A G A C A G A

35 Stutter in Pictures GTCTGTCTGTCTGTCTGTCTGTCT C A G A C A G A C A G A C A G A

36 Stutter in Pictures GTCTGTCTGTCTGTCTGTCTGTCT CAGACAGACAGACAGACAGACAGACAGACAGA GTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCT CAGACAGACAGACAGACAGACAGA

37 GTCTGTCTGTCTGTCTGTCTGTCT CAGACAGACAGACAGACAGACAGACAGACAGA GTCTGTCTGTCTGTCTGTCTGTCTGTCTGTCT CAGACAGACAGACAGACAGACAGA

38 St… St… Stutter!!

39 Stutter Happens So does teeny tiny contribution

40

41 Pop Quiz Why do we care about stutter?

42 A funny thing happened on the way to the forum...

43 Degradation Ahem. DNA degradation.

44 Degradation

45 Things that are insulting to DNA

46 Degradation: I know it when I see it!

47

48 Bonus points: How could increasingly smaller DNA sample size be a problem in a criminal case?

49 When degradation isnt degradation

50 Hint: Monty Pyton wouldnt know... What causes inhibition?

51 Size matters

52 Welterweight champion of the world, 1901 – To paraphrase Joe Walcott, the bigger they are, the faster they fall. Behavior patterns of degraded DNA

53 AmpFlSTR ® Identifiler (Applied Biosystems)

54 Behavior patterns of degraded DNA AmpFlSTR ® Identifiler (Applied Biosystems)

55 Behavior patterns of degraded DNA AmpFlSTR ® Identifiler (Applied Biosystems)

56 AMEL D3S1358 TH01 TPOX D2S1338 D19S433 FGA D21S11 D18S51 CSF1PO D16S539 D7S820 D13S31 7 D5S818 VWA D8S1179 What does this have to do with a ski slope? AmpFlSTR ® Identifiler (Applied Biosystems) Slide courtesy of John Butler The Bigger stuff is over here!! The smaller stuff is over here

57 Option 1

58

59 Option 2 Slide courtesy of Carll Ladd

60

61 New Topic: Peak Height Imbalance

62 Heterozygous peak height balance as a function of signal intensity in RFU units. PHB > 1000 rfus Observed minimum 48%57%58%78% Theoretical minimum Mean -3 SD -mean 40% 80% 54% 85% 63% 88% 75% 92% N Data from Holt, et al., J. Forensic Sci. 2002; 47(1):66-96.

63

64 So what?

65 Primer Binding Site Mutation

66 Capillary Muck Ups: Meet my friends Noise and Blob

67 Noise Happens

68 Whats the problem with noise? You tell me...

69 Blobs

70 So whats the problem? Bonus points if you can tell me how a blob could muck up a DNA profile.

71 Pull Up

72 Questioned Sample

73 New Topic: Spikes

74 Spikes

75 Can you tell me how a spike could impact a DNA profile?

76 More mutations that can mess things up...

77 Triallelic Pattern Positive control sample Known blood sample: 3 band profile at TPOX

78 Known blood sample: D3 profile 17,>19. Sneaky off ladder alleles: D3 Variant Allele

79 Machine Muck Ups

80 Good EPT Data

81 Bad EPT Data

82 Good Raw Data

83 Bad Raw Data

84 Good Rox

85 Bad Rox

86 Allelic Imbalance Impress your friends: Learn the term stochastic effects What happens when you have a small amount of DNA?

87 Allelic Imbalance Amplifications from same dilution tube (~60 pg). ( PM) Allelic imbalance present. Different DNA THO1 and CSF1P0.

88 Allelic Dropout Evidence sample Reference sample

89

90

91 Biased Interpretation of results It is human nature to want to solve the crime. The use of reference samples assists the scientist in this process.

92 D3 vWA FGA Blue Loci* Defendant 17 15, Does he match? *Note the RFU values. This lab uses a 50 RFU cutoff.

93 Defendant 17 15, Is he excluded? -- No, because additional alleles at D3 and FGA are spurious. The 12 is below the threshold and the FGA alleles are off ladder.

94 Defendant 12, 17 15, 17 20, 25 Is he excluded?

95 Defendant 12, 17 15, 17 20, 25 Is he excluded? --No, because stochastic effect or preferential amplification explains peak height disparity at D3; spike (pull-up) at FGA hides 20 allele.

96 Special Thanks Bob Blaiser, Attorney John Butler, National Institute of Science and Technology Simon Ford, Lexigen, Inc. Jennifer Friedman, LA Public Defenders Office Jason Gilder, Forensic Bioinformatics Services Ted Kessis, Applied DNA Resources Dave Knudsen, Minnesota State Public Defenders Office Dan Krane, Forensic Bioinformatics Carll Ladd, Connecticut State Crime Lab Carrie Roland, Forensic Bioinformatics Services Mike Sganga, Senior Scientist, Attorney, Law Office of Michael Burt Bill Thompson, UC Irvine


Download ppt "Things that can muck up a DNA Profile The list is long and distinguished... By Christine Funk, with a lot of help from her friends... Board of Public Defense."

Similar presentations


Ads by Google